Incidental Mutation 'R2316:Stac3'
ID 245501
Institutional Source Beutler Lab
Gene Symbol Stac3
Ensembl Gene ENSMUSG00000040287
Gene Name SH3 and cysteine rich domain 3
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 127337555-127344692 bp(+) (GRCm39)
Type of Mutation splice site (6 bp from exon)
DNA Base Change (assembly) T to C at 127339229 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035839] [ENSMUST00000064793] [ENSMUST00000077046] [ENSMUST00000105249] [ENSMUST00000105250] [ENSMUST00000105251] [ENSMUST00000160019] [ENSMUST00000160610] [ENSMUST00000166820] [ENSMUST00000164161] [ENSMUST00000164831] [ENSMUST00000170336] [ENSMUST00000169888]
AlphaFold Q8BZ71
Predicted Effect probably null
Transcript: ENSMUST00000035839
SMART Domains Protein: ENSMUSP00000048148
Gene: ENSMUSG00000040287

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064793
SMART Domains Protein: ENSMUSP00000069724
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 457 N/A INTRINSIC
low complexity region 699 730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077046
SMART Domains Protein: ENSMUSP00000076303
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 7.4e-14 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105249
SMART Domains Protein: ENSMUSP00000100884
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.4e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 692 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105250
SMART Domains Protein: ENSMUSP00000100885
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105251
SMART Domains Protein: ENSMUSP00000100886
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.6e-12 PFAM
low complexity region 320 332 N/A INTRINSIC
low complexity region 412 443 N/A INTRINSIC
low complexity region 456 481 N/A INTRINSIC
low complexity region 726 757 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160019
SMART Domains Protein: ENSMUSP00000125124
Gene: ENSMUSG00000040287

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
C1 89 139 2.19e-7 SMART
low complexity region 199 213 N/A INTRINSIC
low complexity region 220 238 N/A INTRINSIC
SH3 246 301 1.41e-16 SMART
SH3 305 360 8.45e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160760
Predicted Effect probably benign
Transcript: ENSMUST00000171426
Predicted Effect probably benign
Transcript: ENSMUST00000160610
Predicted Effect probably benign
Transcript: ENSMUST00000166820
SMART Domains Protein: ENSMUSP00000126608
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
Pfam:SUZ 250 303 5.7e-12 PFAM
low complexity region 338 350 N/A INTRINSIC
low complexity region 430 461 N/A INTRINSIC
low complexity region 474 499 N/A INTRINSIC
low complexity region 744 775 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164161
SMART Domains Protein: ENSMUSP00000126185
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164831
SMART Domains Protein: ENSMUSP00000131007
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 678 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170336
SMART Domains Protein: ENSMUSP00000128659
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
low complexity region 15 30 N/A INTRINSIC
low complexity region 109 132 N/A INTRINSIC
R3H 152 229 1.26e-16 SMART
low complexity region 306 318 N/A INTRINSIC
low complexity region 398 429 N/A INTRINSIC
low complexity region 442 467 N/A INTRINSIC
low complexity region 712 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169888
SMART Domains Protein: ENSMUSP00000126760
Gene: ENSMUSG00000025404

DomainStartEndE-ValueType
Pfam:SUZ 7 54 4.7e-12 PFAM
low complexity region 71 83 N/A INTRINSIC
low complexity region 163 194 N/A INTRINSIC
low complexity region 443 474 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the excitation-contraction coupling machinery of muscles. This protein is a member of the Stac gene family and contains an N-terminal cysteine-rich domain and two SH3 domains. Mutations in this gene are a cause of Native American myopathy. [provided by RefSeq, Nov 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, abnormal posture, thin diaphragm muscle, abnormal skeletal muscle morphology characterized by centralized nuclei and disorganized myofibrils, and impaired skeletal muscle contractility due to defective excitation-contraction coupling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Stac3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Stac3 APN 10 127,339,533 (GRCm39) missense probably damaging 1.00
IGL02271:Stac3 APN 10 127,339,768 (GRCm39) missense probably benign 0.00
R0051:Stac3 UTSW 10 127,344,017 (GRCm39) missense probably damaging 0.98
R0090:Stac3 UTSW 10 127,339,799 (GRCm39) unclassified probably benign
R0131:Stac3 UTSW 10 127,339,519 (GRCm39) missense probably damaging 0.97
R0131:Stac3 UTSW 10 127,339,519 (GRCm39) missense probably damaging 0.97
R0132:Stac3 UTSW 10 127,339,519 (GRCm39) missense probably damaging 0.97
R0330:Stac3 UTSW 10 127,343,616 (GRCm39) splice site probably null
R0630:Stac3 UTSW 10 127,343,632 (GRCm39) missense probably damaging 1.00
R1132:Stac3 UTSW 10 127,343,128 (GRCm39) missense probably benign
R1450:Stac3 UTSW 10 127,340,754 (GRCm39) missense probably damaging 1.00
R1739:Stac3 UTSW 10 127,343,635 (GRCm39) missense probably benign 0.40
R2511:Stac3 UTSW 10 127,339,787 (GRCm39) critical splice donor site probably null
R3000:Stac3 UTSW 10 127,344,016 (GRCm39) missense probably benign 0.01
R4324:Stac3 UTSW 10 127,339,118 (GRCm39) missense probably damaging 0.99
R4758:Stac3 UTSW 10 127,339,214 (GRCm39) missense possibly damaging 0.95
R5040:Stac3 UTSW 10 127,343,993 (GRCm39) missense probably damaging 0.98
R6244:Stac3 UTSW 10 127,344,044 (GRCm39) missense probably damaging 1.00
R6275:Stac3 UTSW 10 127,343,615 (GRCm39) nonsense probably null
R7335:Stac3 UTSW 10 127,340,769 (GRCm39) missense probably benign 0.22
R8191:Stac3 UTSW 10 127,344,068 (GRCm39) missense probably damaging 1.00
R8290:Stac3 UTSW 10 127,339,229 (GRCm39) splice site probably null
R8410:Stac3 UTSW 10 127,339,199 (GRCm39) missense probably damaging 1.00
R8690:Stac3 UTSW 10 127,339,494 (GRCm39) missense probably damaging 1.00
R8799:Stac3 UTSW 10 127,340,781 (GRCm39) missense probably damaging 0.98
R9008:Stac3 UTSW 10 127,339,454 (GRCm39) missense probably damaging 1.00
R9095:Stac3 UTSW 10 127,343,584 (GRCm39) missense probably damaging 1.00
R9594:Stac3 UTSW 10 127,338,654 (GRCm39) start codon destroyed probably null 0.53
R9759:Stac3 UTSW 10 127,344,083 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- TCTCCAGAGACAGCTGAGATGG -3'
(R):5'- TGCAGCGGAGTCCAAACTTG -3'

Sequencing Primer
(F):5'- ACAGCTGAGATGGAGCCTC -3'
(R):5'- CAGCGGAGTCCAAACTTGTTATTGAC -3'
Posted On 2014-10-30