Incidental Mutation 'R2316:Stat5b'
ID 245504
Institutional Source Beutler Lab
Gene Symbol Stat5b
Ensembl Gene ENSMUSG00000020919
Gene Name signal transducer and activator of transcription 5B
Synonyms
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 100671557-100741407 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 100687318 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 436 (T436K)
Ref Sequence ENSEMBL: ENSMUSP00000102981 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004143] [ENSMUST00000107358]
AlphaFold P42232
Predicted Effect probably damaging
Transcript: ENSMUST00000004143
AA Change: T436K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004143
Gene: ENSMUSG00000020919
AA Change: T436K

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 138 330 1e-57 PFAM
Pfam:STAT_bind 332 583 1.6e-100 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107358
AA Change: T436K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102981
Gene: ENSMUSG00000020919
AA Change: T436K

DomainStartEndE-ValueType
STAT_int 2 126 2.3e-60 SMART
Pfam:STAT_alpha 141 330 7.1e-56 PFAM
Pfam:STAT_bind 332 582 3.3e-105 PFAM
SH2 587 676 3.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126266
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein mediates the signal transduction triggered by various cell ligands, such as IL2, IL4, CSF1, and different growth hormones. It has been shown to be involved in diverse biological processes, such as TCR signaling, apoptosis, adult mammary gland development, and sexual dimorphism of liver gene expression. This gene was found to fuse to retinoic acid receptor-alpha (RARA) gene in a small subset of acute promyelocytic leukemias (APLL). The dysregulation of the signaling pathways mediated by this protein may be the cause of the APLL. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this are reduced in size and mammary glands secrete reduced levels of some milk proteins during lactation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Zfp677 A T 17: 21,617,582 (GRCm39) Y213F probably benign Het
Other mutations in Stat5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02208:Stat5b APN 11 100,695,739 (GRCm39) missense probably damaging 1.00
IGL02675:Stat5b APN 11 100,678,200 (GRCm39) missense probably benign 0.26
IGL02683:Stat5b APN 11 100,695,772 (GRCm39) missense probably benign 0.11
IGL02725:Stat5b APN 11 100,695,840 (GRCm39) missense possibly damaging 0.91
R0305:Stat5b UTSW 11 100,693,329 (GRCm39) missense probably benign 0.00
R0315:Stat5b UTSW 11 100,679,286 (GRCm39) missense probably benign 0.01
R0452:Stat5b UTSW 11 100,689,156 (GRCm39) missense probably benign 0.00
R1267:Stat5b UTSW 11 100,689,419 (GRCm39) missense probably benign 0.08
R1527:Stat5b UTSW 11 100,699,220 (GRCm39) critical splice donor site probably null
R2059:Stat5b UTSW 11 100,678,158 (GRCm39) missense probably benign 0.12
R2990:Stat5b UTSW 11 100,699,188 (GRCm39) splice site probably null
R4380:Stat5b UTSW 11 100,678,175 (GRCm39) missense probably damaging 1.00
R4478:Stat5b UTSW 11 100,678,110 (GRCm39) missense probably benign 0.31
R4584:Stat5b UTSW 11 100,678,064 (GRCm39) missense probably damaging 1.00
R4806:Stat5b UTSW 11 100,681,623 (GRCm39) missense probably benign
R4931:Stat5b UTSW 11 100,675,080 (GRCm39) nonsense probably null
R5008:Stat5b UTSW 11 100,693,309 (GRCm39) missense probably benign 0.00
R5015:Stat5b UTSW 11 100,695,831 (GRCm39) missense possibly damaging 0.64
R5072:Stat5b UTSW 11 100,699,361 (GRCm39) critical splice acceptor site probably null
R5601:Stat5b UTSW 11 100,674,001 (GRCm39) missense probably damaging 0.99
R5638:Stat5b UTSW 11 100,675,080 (GRCm39) nonsense probably null
R5901:Stat5b UTSW 11 100,695,733 (GRCm39) missense possibly damaging 0.62
R6577:Stat5b UTSW 11 100,688,526 (GRCm39) missense probably benign 0.00
R7882:Stat5b UTSW 11 100,674,601 (GRCm39) missense possibly damaging 0.55
R8147:Stat5b UTSW 11 100,688,607 (GRCm39) missense probably benign 0.06
R8188:Stat5b UTSW 11 100,692,262 (GRCm39) missense probably damaging 1.00
R9022:Stat5b UTSW 11 100,681,634 (GRCm39) missense probably benign
R9114:Stat5b UTSW 11 100,692,350 (GRCm39) missense probably damaging 0.97
R9449:Stat5b UTSW 11 100,681,674 (GRCm39) missense probably benign 0.00
R9489:Stat5b UTSW 11 100,699,276 (GRCm39) missense possibly damaging 0.50
R9492:Stat5b UTSW 11 100,692,361 (GRCm39) missense probably benign 0.01
R9605:Stat5b UTSW 11 100,699,276 (GRCm39) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GCTGTATATTTATTGGCATGCGTAC -3'
(R):5'- TCTGTCTGATTCGCAGTGATTAC -3'

Sequencing Primer
(F):5'- TGGCATGCGTACTGAGTACATACAC -3'
(R):5'- GATCCTGAACAACTGTTGCG -3'
Posted On 2014-10-30