Incidental Mutation 'R2316:Zfp677'
ID 245513
Institutional Source Beutler Lab
Gene Symbol Zfp677
Ensembl Gene ENSMUSG00000062743
Gene Name zinc finger protein 677
Synonyms A830058L05Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R2316 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 21604010-21619527 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 21617582 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 213 (Y213F)
Ref Sequence ENSEMBL: ENSMUSP00000125295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056107] [ENSMUST00000162659]
AlphaFold Q6PEP4
Predicted Effect probably benign
Transcript: ENSMUST00000056107
AA Change: Y213F

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000052667
Gene: ENSMUSG00000062743
AA Change: Y213F

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162659
AA Change: Y213F

PolyPhen 2 Score 0.379 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125295
Gene: ENSMUSG00000062743
AA Change: Y213F

DomainStartEndE-ValueType
KRAB 13 75 1.11e-21 SMART
Pfam:zf-H2C2_2 118 140 2.9e-5 PFAM
ZnF_C2H2 185 207 2.95e-3 SMART
ZnF_C2H2 213 235 3.95e-4 SMART
ZnF_C2H2 241 263 2.09e-3 SMART
ZnF_C2H2 269 291 6.42e-4 SMART
ZnF_C2H2 297 319 5.5e-3 SMART
ZnF_C2H2 325 347 1.98e-4 SMART
ZnF_C2H2 353 375 1.98e-4 SMART
ZnF_C2H2 381 403 1.47e-3 SMART
ZnF_C2H2 409 431 1.28e-3 SMART
ZnF_C2H2 437 459 3.95e-4 SMART
ZnF_C2H2 465 487 1.04e-3 SMART
ZnF_C2H2 493 515 8.47e-4 SMART
ZnF_C2H2 521 543 7.49e-5 SMART
ZnF_C2H2 549 571 1.18e-2 SMART
ZnF_C2H2 577 599 6.08e-5 SMART
ZnF_C2H2 610 632 4.17e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232365
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,333,519 (GRCm39) probably benign Het
Acaca T C 11: 84,154,906 (GRCm39) M987T probably benign Het
Acaca A G 11: 84,185,809 (GRCm39) T115A possibly damaging Het
Aknad1 A T 3: 108,688,472 (GRCm39) D600V probably damaging Het
Arfgef3 T A 10: 18,492,701 (GRCm39) T1237S probably benign Het
Brd4 A T 17: 32,431,884 (GRCm39) L660Q probably benign Het
Casp1 A G 9: 5,306,213 (GRCm39) D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 (GRCm39) S951R probably benign Het
Chd9 A G 8: 91,777,756 (GRCm39) E2589G probably damaging Het
Dchs1 T C 7: 105,413,411 (GRCm39) T1135A possibly damaging Het
Dnhd1 T C 7: 105,323,628 (GRCm39) V633A probably damaging Het
Dock6 G T 9: 21,750,973 (GRCm39) H400Q probably damaging Het
Dzip1 A G 14: 119,138,952 (GRCm39) F426L probably benign Het
Elovl4 A G 9: 83,662,826 (GRCm39) S236P probably damaging Het
Emp1 T C 6: 135,357,123 (GRCm39) F67S probably damaging Het
Garnl3 A G 2: 32,895,164 (GRCm39) L635P probably damaging Het
Htr7 C A 19: 35,946,703 (GRCm39) probably null Het
Kcnd3 A C 3: 105,576,442 (GRCm39) S629R probably benign Het
Lrp2 T A 2: 69,322,191 (GRCm39) I1913F possibly damaging Het
Med19 T A 2: 84,516,587 (GRCm39) D208E probably benign Het
Mettl21c A T 1: 44,052,792 (GRCm39) V75E probably damaging Het
Nhsl3 T C 4: 129,117,540 (GRCm39) T375A probably damaging Het
Nsd1 A T 13: 55,381,779 (GRCm39) R64S probably damaging Het
Or10g3b A G 14: 52,587,395 (GRCm39) I36T probably benign Het
Or51v8 A T 7: 103,319,674 (GRCm39) I188N probably damaging Het
Or5p50 T A 7: 107,422,007 (GRCm39) Y223F probably benign Het
Peds1 T A 2: 167,496,635 (GRCm39) Q46L possibly damaging Het
Plat T A 8: 23,266,881 (GRCm39) M291K probably benign Het
Psmb4 T C 3: 94,792,322 (GRCm39) E200G probably benign Het
Reln T C 5: 22,359,954 (GRCm39) Y190C probably benign Het
Rp1 A G 1: 4,415,863 (GRCm39) S1750P probably damaging Het
Slc5a4a T A 10: 76,013,915 (GRCm39) probably null Het
Sobp A T 10: 43,034,034 (GRCm39) N97K possibly damaging Het
Stac3 T C 10: 127,339,229 (GRCm39) probably null Het
Stat5b G T 11: 100,687,318 (GRCm39) T436K probably damaging Het
Tas1r3 A T 4: 155,947,772 (GRCm39) M7K probably benign Het
Vps13b C T 15: 35,675,045 (GRCm39) Q1722* probably null Het
Other mutations in Zfp677
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Zfp677 APN 17 21,617,930 (GRCm39) missense probably benign 0.33
IGL01973:Zfp677 APN 17 21,617,169 (GRCm39) missense probably damaging 1.00
IGL02206:Zfp677 APN 17 21,613,499 (GRCm39) missense probably damaging 1.00
IGL03240:Zfp677 APN 17 21,617,135 (GRCm39) missense probably damaging 0.99
IGL03409:Zfp677 APN 17 21,617,107 (GRCm39) missense probably damaging 1.00
R0622:Zfp677 UTSW 17 21,617,962 (GRCm39) missense probably benign 0.04
R0972:Zfp677 UTSW 17 21,618,572 (GRCm39) missense probably damaging 1.00
R1519:Zfp677 UTSW 17 21,617,499 (GRCm39) missense possibly damaging 0.91
R2155:Zfp677 UTSW 17 21,617,970 (GRCm39) missense probably benign 0.01
R2866:Zfp677 UTSW 17 21,617,518 (GRCm39) nonsense probably null
R2989:Zfp677 UTSW 17 21,617,114 (GRCm39) missense probably benign 0.11
R3955:Zfp677 UTSW 17 21,618,079 (GRCm39) missense possibly damaging 0.95
R4075:Zfp677 UTSW 17 21,618,421 (GRCm39) missense probably damaging 1.00
R4134:Zfp677 UTSW 17 21,618,043 (GRCm39) missense probably benign 0.01
R4229:Zfp677 UTSW 17 21,618,544 (GRCm39) missense probably damaging 1.00
R4729:Zfp677 UTSW 17 21,617,680 (GRCm39) missense possibly damaging 0.51
R4843:Zfp677 UTSW 17 21,612,788 (GRCm39) missense probably benign 0.23
R5023:Zfp677 UTSW 17 21,618,056 (GRCm39) missense probably damaging 1.00
R5316:Zfp677 UTSW 17 21,617,410 (GRCm39) missense probably damaging 0.99
R5420:Zfp677 UTSW 17 21,618,175 (GRCm39) missense probably damaging 1.00
R5694:Zfp677 UTSW 17 21,618,021 (GRCm39) missense probably damaging 0.99
R5837:Zfp677 UTSW 17 21,617,648 (GRCm39) missense probably damaging 1.00
R5888:Zfp677 UTSW 17 21,618,520 (GRCm39) missense probably damaging 1.00
R6007:Zfp677 UTSW 17 21,617,918 (GRCm39) missense probably damaging 1.00
R6119:Zfp677 UTSW 17 21,618,070 (GRCm39) missense possibly damaging 0.55
R6190:Zfp677 UTSW 17 21,617,530 (GRCm39) missense possibly damaging 0.91
R6518:Zfp677 UTSW 17 21,618,392 (GRCm39) missense probably damaging 1.00
R7198:Zfp677 UTSW 17 21,618,679 (GRCm39) missense probably damaging 1.00
R7391:Zfp677 UTSW 17 21,618,653 (GRCm39) missense possibly damaging 0.56
R7801:Zfp677 UTSW 17 21,618,277 (GRCm39) missense probably damaging 1.00
R7808:Zfp677 UTSW 17 21,617,647 (GRCm39) missense probably damaging 1.00
R8202:Zfp677 UTSW 17 21,613,535 (GRCm39) missense probably damaging 1.00
R8206:Zfp677 UTSW 17 21,612,717 (GRCm39) splice site probably null
R8885:Zfp677 UTSW 17 21,618,350 (GRCm39) missense probably benign
R8965:Zfp677 UTSW 17 21,617,155 (GRCm39) missense probably damaging 1.00
R9062:Zfp677 UTSW 17 21,612,815 (GRCm39) critical splice donor site probably null
R9167:Zfp677 UTSW 17 21,613,460 (GRCm39) missense probably damaging 1.00
R9371:Zfp677 UTSW 17 21,618,053 (GRCm39) missense probably damaging 1.00
R9638:Zfp677 UTSW 17 21,618,056 (GRCm39) missense probably damaging 1.00
R9752:Zfp677 UTSW 17 21,618,511 (GRCm39) missense probably damaging 1.00
RF003:Zfp677 UTSW 17 21,617,704 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTCAGTTTGCGTTCCAAC -3'
(R):5'- TTTGTATGGCTTCGCTCCAG -3'

Sequencing Primer
(F):5'- GCGTTCCAACATTAGTCAAGATCAG -3'
(R):5'- GCTCCAGGATGCAAATTCTG -3'
Posted On 2014-10-30