Incidental Mutation 'R2316:Htr7'
ID245517
Institutional Source Beutler Lab
Gene Symbol Htr7
Ensembl Gene ENSMUSG00000024798
Gene Name5-hydroxytryptamine (serotonin) receptor 7
Synonyms5-HT7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2316 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location35958734-36057507 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 35969303 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099505] [ENSMUST00000164639] [ENSMUST00000164781] [ENSMUST00000165215] [ENSMUST00000166074] [ENSMUST00000170360]
Predicted Effect probably benign
Transcript: ENSMUST00000099505
SMART Domains Protein: ENSMUSP00000097105
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.3e-9 PFAM
Pfam:7tm_1 101 387 4.8e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164639
SMART Domains Protein: ENSMUSP00000126847
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 1.3e-9 PFAM
Pfam:7tm_1 101 387 1.7e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164781
SMART Domains Protein: ENSMUSP00000131912
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 185 2.8e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165215
SMART Domains Protein: ENSMUSP00000128386
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
low complexity region 90 99 N/A INTRINSIC
Pfam:7tm_1 101 183 7.1e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166074
SMART Domains Protein: ENSMUSP00000126150
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 402 2.7e-9 PFAM
Pfam:7tm_1 101 387 5.6e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170360
SMART Domains Protein: ENSMUSP00000131517
Gene: ENSMUSG00000024798

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 95 247 9.6e-9 PFAM
Pfam:7tm_1 101 252 1.4e-49 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The neurotransmitter, serotonin, is thought to play a role in various cognitive and behavioral functions. The serotonin receptor encoded by this gene belongs to the superfamily of G protein-coupled receptors and the gene is a candidate locus for involvement in autistic disorder and other neuropsychiatric disorders. Three splice variants have been identified which encode proteins that differ in the length of their carboxy terminal ends. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower electrically- and chemically-induced seizure thresholds. Mice homozygous for a different knock-out allele show enhanced coordination and higher thermal nociceptive thresholds. Other nullizygous mutantsfail to exhibit agonist-induced hypothermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563I02Rik A G 14: 60,096,070 probably benign Het
Acaca T C 11: 84,264,080 M987T probably benign Het
Acaca A G 11: 84,294,983 T115A possibly damaging Het
Aknad1 A T 3: 108,781,156 D600V probably damaging Het
Arfgef3 T A 10: 18,616,953 T1237S probably benign Het
Brd4 A T 17: 32,212,910 L660Q probably benign Het
C77080 T C 4: 129,223,747 T375A probably damaging Het
Casp1 A G 9: 5,306,213 D366G possibly damaging Het
Casp8ap2 C A 4: 32,643,781 S951R probably benign Het
Chd9 A G 8: 91,051,128 E2589G probably damaging Het
Dchs1 T C 7: 105,764,204 T1135A possibly damaging Het
Dnhd1 T C 7: 105,674,421 V633A probably damaging Het
Dock6 G T 9: 21,839,677 H400Q probably damaging Het
Dzip1 A G 14: 118,901,540 F426L probably benign Het
Elovl4 A G 9: 83,780,773 S236P probably damaging Het
Emp1 T C 6: 135,380,125 F67S probably damaging Het
Garnl3 A G 2: 33,005,152 L635P probably damaging Het
Kcnd3 A C 3: 105,669,126 S629R probably benign Het
Lrp2 T A 2: 69,491,847 I1913F possibly damaging Het
Med19 T A 2: 84,686,243 D208E probably benign Het
Mettl21c A T 1: 44,013,632 V75E probably damaging Het
Nsd1 A T 13: 55,233,966 R64S probably damaging Het
Olfr1513 A G 14: 52,349,938 I36T probably benign Het
Olfr469 T A 7: 107,822,800 Y223F probably benign Het
Olfr624 A T 7: 103,670,467 I188N probably damaging Het
Plat T A 8: 22,776,865 M291K probably benign Het
Psmb4 T C 3: 94,885,011 E200G probably benign Het
Reln T C 5: 22,154,956 Y190C probably benign Het
Rp1 A G 1: 4,345,640 S1750P probably damaging Het
Slc5a4a T A 10: 76,178,081 probably null Het
Sobp A T 10: 43,158,038 N97K possibly damaging Het
Stac3 T C 10: 127,503,360 probably null Het
Stat5b G T 11: 100,796,492 T436K probably damaging Het
Tas1r3 A T 4: 155,863,315 M7K probably benign Het
Tmem189 T A 2: 167,654,715 Q46L possibly damaging Het
Vps13b C T 15: 35,674,899 Q1722* probably null Het
Zfp677 A T 17: 21,397,320 Y213F probably benign Het
Other mutations in Htr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02683:Htr7 APN 19 35960362 missense probably benign 0.00
R0009:Htr7 UTSW 19 36041540 intron probably benign
R0318:Htr7 UTSW 19 35969486 missense probably damaging 1.00
R1695:Htr7 UTSW 19 35969736 missense probably benign 0.01
R3973:Htr7 UTSW 19 36056760 missense probably damaging 1.00
R5041:Htr7 UTSW 19 36057067 missense probably benign 0.10
R5203:Htr7 UTSW 19 35964392 missense probably benign 0.00
R5236:Htr7 UTSW 19 36056769 missense probably damaging 1.00
R5538:Htr7 UTSW 19 35969835 missense probably benign 0.34
R5682:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5683:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5684:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5686:Htr7 UTSW 19 35969871 missense probably damaging 1.00
R5694:Htr7 UTSW 19 36057121 missense probably benign 0.00
R6273:Htr7 UTSW 19 36041569 intron probably benign
R6502:Htr7 UTSW 19 35969610 missense probably damaging 1.00
R6558:Htr7 UTSW 19 36057240 missense probably damaging 1.00
R6884:Htr7 UTSW 19 35964379 critical splice donor site probably null
R7074:Htr7 UTSW 19 36056883 missense probably damaging 0.99
R7592:Htr7 UTSW 19 36056892 missense probably damaging 1.00
X0064:Htr7 UTSW 19 36056755 missense possibly damaging 0.70
Z1176:Htr7 UTSW 19 35969423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAATACCAACCTGTCTTGTGG -3'
(R):5'- TGGGCTATGCAAACTCTCTC -3'

Sequencing Primer
(F):5'- ACCTGTCTTGTGGGTTCTTTAAAAC -3'
(R):5'- GGGCTATGCAAACTCTCTCATTAAC -3'
Posted On2014-10-30