Incidental Mutation 'R2317:Sprr2f'
ID245519
Institutional Source Beutler Lab
Gene Symbol Sprr2f
Ensembl Gene ENSMUSG00000050635
Gene Namesmall proline-rich protein 2F
Synonyms
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location92365187-92366442 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92366083 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 63 (P63H)
Ref Sequence ENSEMBL: ENSMUSP00000050902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050397]
Predicted Effect unknown
Transcript: ENSMUST00000050397
AA Change: P63H
SMART Domains Protein: ENSMUSP00000050902
Gene: ENSMUSG00000050635
AA Change: P63H

DomainStartEndE-ValueType
Pfam:SPRR2 2 73 6.4e-23 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Sprr2f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02477:Sprr2f APN 3 92365897 start codon destroyed probably null
R4537:Sprr2f UTSW 3 92366059 missense unknown
R4824:Sprr2f UTSW 3 92365896 start codon destroyed probably null
R6217:Sprr2f UTSW 3 92366059 missense unknown
R7427:Sprr2f UTSW 3 92365944 missense unknown
R7428:Sprr2f UTSW 3 92365944 missense unknown
R7574:Sprr2f UTSW 3 92365947 missense unknown
Predicted Primers PCR Primer
(F):5'- TTACCAAGAACAGCAGTGCAAG -3'
(R):5'- CAGCAAGATTATAGTCTCGGGC -3'

Sequencing Primer
(F):5'- GCAGTGCAAGCAACCCTG -3'
(R):5'- GCAAGATTATAGTCTCGGGCAAATTC -3'
Posted On2014-10-30