Incidental Mutation 'R2317:Eif2b4'
ID245521
Institutional Source Beutler Lab
Gene Symbol Eif2b4
Ensembl Gene ENSMUSG00000029145
Gene Nameeukaryotic translation initiation factor 2B, subunit 4 delta
SynonymsEif2b
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location31187558-31193430 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 31191576 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031029] [ENSMUST00000077693] [ENSMUST00000114603] [ENSMUST00000166769] [ENSMUST00000200730] [ENSMUST00000201154] [ENSMUST00000201535] [ENSMUST00000201679] [ENSMUST00000202124] [ENSMUST00000202758]
Predicted Effect probably benign
Transcript: ENSMUST00000031029
SMART Domains Protein: ENSMUSP00000031029
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 105 3.42e-24 SMART
B41 113 274 4.05e-2 SMART
low complexity region 324 342 N/A INTRINSIC
low complexity region 428 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077693
AA Change: Q128R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076875
Gene: ENSMUSG00000029145
AA Change: Q128R

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 29 60 N/A INTRINSIC
coiled coil region 93 122 N/A INTRINSIC
Pfam:IF-2B 219 510 3.4e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114603
AA Change: Q148R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110250
Gene: ENSMUSG00000029145
AA Change: Q148R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114605
AA Change: Q170R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110252
Gene: ENSMUSG00000029145
AA Change: Q170R

DomainStartEndE-ValueType
coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166769
AA Change: Q148R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130880
Gene: ENSMUSG00000029145
AA Change: Q148R

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
coiled coil region 113 142 N/A INTRINSIC
Pfam:IF-2B 239 530 3.8e-97 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000200724
AA Change: Q24R
Predicted Effect probably benign
Transcript: ENSMUST00000200730
SMART Domains Protein: ENSMUSP00000144504
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
PX 1 87 2.3e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000200741
Predicted Effect probably null
Transcript: ENSMUST00000200929
Predicted Effect probably null
Transcript: ENSMUST00000200977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200983
Predicted Effect probably benign
Transcript: ENSMUST00000201154
SMART Domains Protein: ENSMUSP00000143802
Gene: ENSMUSG00000029145

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
coiled coil region 49 80 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201343
Predicted Effect probably benign
Transcript: ENSMUST00000201535
SMART Domains Protein: ENSMUSP00000144643
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 23 3e-7 BLAST
PDB:3LUI|C 1 23 3e-8 PDB
low complexity region 24 35 N/A INTRINSIC
Blast:B41 36 169 5e-92 BLAST
PDB:4GXB|A 36 169 4e-90 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000201679
SMART Domains Protein: ENSMUSP00000144688
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Pfam:PX 6 67 2.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202032
Predicted Effect probably benign
Transcript: ENSMUST00000202124
SMART Domains Protein: ENSMUSP00000144168
Gene: ENSMUSG00000029146

DomainStartEndE-ValueType
Blast:PX 1 31 6e-8 BLAST
PDB:3LUI|C 1 31 4e-9 PDB
low complexity region 41 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202743
Predicted Effect probably benign
Transcript: ENSMUST00000202758
AA Change: Q170R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000144361
Gene: ENSMUSG00000029145
AA Change: Q170R

DomainStartEndE-ValueType
coiled coil region 71 102 N/A INTRINSIC
coiled coil region 135 164 N/A INTRINSIC
Pfam:IF-2B 261 552 2.3e-97 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic initiation factor 2B (EIF2B), which is necessary for protein synthesis, is a GTP exchange factor composed of five different subunits. The protein encoded by this gene is the fourth, or delta, subunit. Defects in this gene are a cause of leukoencephalopathy with vanishing white matter (VWM) and ovarioleukodystrophy. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Eif2b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Eif2b4 APN 5 31187767 missense probably benign 0.02
IGL02525:Eif2b4 APN 5 31189618 missense probably damaging 0.99
IGL03178:Eif2b4 APN 5 31187653 missense probably damaging 1.00
IGL03267:Eif2b4 APN 5 31192659 missense possibly damaging 0.90
IGL03379:Eif2b4 APN 5 31190011 splice site probably benign
IGL03397:Eif2b4 APN 5 31187653 missense probably damaging 1.00
R0346:Eif2b4 UTSW 5 31188108 splice site probably benign
R1549:Eif2b4 UTSW 5 31192921 missense possibly damaging 0.72
R1636:Eif2b4 UTSW 5 31192266 unclassified probably null
R1753:Eif2b4 UTSW 5 31192940 missense probably benign 0.00
R2263:Eif2b4 UTSW 5 31192574 splice site probably benign
R3808:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R3809:Eif2b4 UTSW 5 31191168 missense possibly damaging 0.95
R4746:Eif2b4 UTSW 5 31187653 missense probably damaging 1.00
R4752:Eif2b4 UTSW 5 31191231 nonsense probably null
R4798:Eif2b4 UTSW 5 31189520 intron probably benign
R4895:Eif2b4 UTSW 5 31192954 missense probably benign 0.00
R4936:Eif2b4 UTSW 5 31192897 missense probably benign 0.00
R5588:Eif2b4 UTSW 5 31192173 nonsense probably null
R5660:Eif2b4 UTSW 5 31191156 missense probably benign 0.00
R6363:Eif2b4 UTSW 5 31191239 missense probably damaging 0.99
R6653:Eif2b4 UTSW 5 31192207 missense possibly damaging 0.89
R6750:Eif2b4 UTSW 5 31189960 missense probably damaging 0.99
R7062:Eif2b4 UTSW 5 31192831 missense probably benign
R7221:Eif2b4 UTSW 5 31187787 missense possibly damaging 0.55
R7360:Eif2b4 UTSW 5 31191375 missense probably benign 0.08
R7779:Eif2b4 UTSW 5 31190654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGAAGTGTGGGGTCATCAG -3'
(R):5'- AGAGATCACCGTCCTAGAGC -3'

Sequencing Primer
(F):5'- CATCAGCTGGGGTGTGCTC -3'
(R):5'- TAGAGCCCAGGCACCTCTTC -3'
Posted On2014-10-30