Incidental Mutation 'R2317:Stt3a'
ID245526
Institutional Source Beutler Lab
Gene Symbol Stt3a
Ensembl Gene ENSMUSG00000032116
Gene NameSTT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
SynonymsItm1
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location36729344-36767679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36748075 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 323 (I323V)
Ref Sequence ENSEMBL: ENSMUSP00000113116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120381] [ENSMUST00000128270]
Predicted Effect probably benign
Transcript: ENSMUST00000120381
AA Change: I323V

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000113116
Gene: ENSMUSG00000032116
AA Change: I323V

DomainStartEndE-ValueType
Pfam:STT3 17 484 2e-163 PFAM
Pfam:PMT_2 97 257 9.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128270
Predicted Effect probably benign
Transcript: ENSMUST00000135934
SMART Domains Protein: ENSMUSP00000117794
Gene: ENSMUSG00000032116

DomainStartEndE-ValueType
Pfam:STT3 1 112 1.8e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215998
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a catalytic subunit of the N-oligosaccharyltransferase (OST) complex, which functions in the endoplasmic reticulum to transfer glycan chains to asparagine residues of target proteins. A separate complex containing a similar catalytic subunit with an overlapping function also exists. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Stt3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Stt3a APN 9 36734366 missense probably benign 0.00
IGL02237:Stt3a APN 9 36749637 nonsense probably null
IGL02644:Stt3a APN 9 36752353 missense possibly damaging 0.70
IGL02710:Stt3a APN 9 36758745 missense probably damaging 0.99
IGL03085:Stt3a APN 9 36732970 intron probably benign
IGL03180:Stt3a APN 9 36759256 missense probably damaging 1.00
IGL03295:Stt3a APN 9 36763331 splice site probably null
Scramble UTSW 9 36735466 missense probably damaging 1.00
Western UTSW 9 36735386 missense probably damaging 1.00
R0314:Stt3a UTSW 9 36749545 intron probably benign
R0731:Stt3a UTSW 9 36735512 missense probably damaging 1.00
R1188:Stt3a UTSW 9 36751340 missense probably damaging 1.00
R1797:Stt3a UTSW 9 36743415 critical splice donor site probably null
R1846:Stt3a UTSW 9 36763385 missense probably damaging 1.00
R2152:Stt3a UTSW 9 36747996 missense probably damaging 1.00
R2220:Stt3a UTSW 9 36749551 critical splice donor site probably null
R3689:Stt3a UTSW 9 36759322 missense probably damaging 1.00
R4299:Stt3a UTSW 9 36763344 missense probably damaging 1.00
R4586:Stt3a UTSW 9 36741793 missense probably damaging 1.00
R4595:Stt3a UTSW 9 36735512 missense probably damaging 1.00
R4689:Stt3a UTSW 9 36732929 missense possibly damaging 0.91
R4736:Stt3a UTSW 9 36749712 missense probably benign 0.01
R5145:Stt3a UTSW 9 36735466 missense probably damaging 1.00
R5208:Stt3a UTSW 9 36746595 missense possibly damaging 0.78
R5665:Stt3a UTSW 9 36759314 missense probably damaging 1.00
R5748:Stt3a UTSW 9 36752400 missense probably benign 0.21
R6341:Stt3a UTSW 9 36751296 missense probably damaging 1.00
R6853:Stt3a UTSW 9 36741727 missense possibly damaging 0.89
R6859:Stt3a UTSW 9 36735386 missense probably damaging 1.00
R7453:Stt3a UTSW 9 36747970 missense possibly damaging 0.91
R7495:Stt3a UTSW 9 36747939 missense probably benign 0.03
R7745:Stt3a UTSW 9 36751239 nonsense probably null
R8007:Stt3a UTSW 9 36741769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAAAATGCAAGACAGACCTGG -3'
(R):5'- AGTCTGGAATATAAAGCGTGGC -3'

Sequencing Primer
(F):5'- TGCAAGACAGACCTGGAAACATG -3'
(R):5'- AGGGAACTCCTGCTTCAGACATG -3'
Posted On2014-10-30