Incidental Mutation 'R2317:Slc25a36'
ID245527
Institutional Source Beutler Lab
Gene Symbol Slc25a36
Ensembl Gene ENSMUSG00000032449
Gene Namesolute carrier family 25, member 36
SynonymsC330005L02Rik
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.320) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location97074961-97111157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 97079182 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 267 (T267I)
Ref Sequence ENSEMBL: ENSMUSP00000082302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035024] [ENSMUST00000085206] [ENSMUST00000153070]
Predicted Effect probably damaging
Transcript: ENSMUST00000035024
AA Change: T128I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035024
Gene: ENSMUSG00000032449
AA Change: T128I

DomainStartEndE-ValueType
Pfam:Mito_carr 4 69 1.1e-12 PFAM
Pfam:Mito_carr 83 172 2.7e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085206
AA Change: T267I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000082302
Gene: ENSMUSG00000032449
AA Change: T267I

DomainStartEndE-ValueType
Pfam:Mito_carr 2 113 9.5e-27 PFAM
Pfam:Mito_carr 114 207 2.5e-23 PFAM
Pfam:Mito_carr 222 311 6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148995
Predicted Effect probably benign
Transcript: ENSMUST00000153070
SMART Domains Protein: ENSMUSP00000116813
Gene: ENSMUSG00000032449

DomainStartEndE-ValueType
Pfam:Mito_carr 2 113 5.8e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155291
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Slc25a36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Slc25a36 APN 9 97079233 missense probably benign 0.01
IGL01634:Slc25a36 APN 9 97080481 missense probably benign 0.00
IGL02149:Slc25a36 APN 9 97093069 splice site probably benign
R0394:Slc25a36 UTSW 9 97080204 missense probably benign 0.36
R0518:Slc25a36 UTSW 9 97097175 missense probably damaging 1.00
R1024:Slc25a36 UTSW 9 97079201 missense probably damaging 1.00
R1208:Slc25a36 UTSW 9 97085135 splice site probably benign
R1439:Slc25a36 UTSW 9 97093073 splice site probably benign
R1466:Slc25a36 UTSW 9 97080355 missense probably damaging 1.00
R1466:Slc25a36 UTSW 9 97080355 missense probably damaging 1.00
R1920:Slc25a36 UTSW 9 97093082 missense probably benign 0.00
R2247:Slc25a36 UTSW 9 97100138 missense probably damaging 1.00
R2518:Slc25a36 UTSW 9 97079071 missense possibly damaging 0.95
R3756:Slc25a36 UTSW 9 97100155 nonsense probably null
R4405:Slc25a36 UTSW 9 97085118 missense probably benign 0.00
R4624:Slc25a36 UTSW 9 97079125 missense probably damaging 0.99
R4719:Slc25a36 UTSW 9 97090119 utr 3 prime probably benign
R5492:Slc25a36 UTSW 9 97100206 missense probably damaging 1.00
R6152:Slc25a36 UTSW 9 97100157 missense probably damaging 1.00
R7823:Slc25a36 UTSW 9 97084391 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGCTGGCTTCAAGATTCC -3'
(R):5'- ACTGGTCTCAGGAAGCTAGC -3'

Sequencing Primer
(F):5'- AAGATTCCATGGTCCACTGTG -3'
(R):5'- CTGGTCTCAGGAAGCTAGCTATAC -3'
Posted On2014-10-30