Mutagenetix > Incidental Mutations

Incidental Mutation 'R2317:Pdcd6ip'

245528

Institutional Source

Beutler Lab

Gene Symbol

Pdcd6ip

Ensembl Gene

ENSMUSG00000032504

Gene Name

programmed cell death 6 interacting protein

Synonyms

Alix, AIP1

MMRRC Submission

040312-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2317 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113651744-113708259 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 113672774 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 467 (D467G)

Ref Sequence

ENSEMBL: ENSMUSP00000035086 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035086] [ENSMUST00000111861]

Predicted Effect

probably benign
Transcript: ENSMUST00000035086
AA Change: D467G

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000035086
Gene: ENSMUSG00000032504
AA Change: D467G

Domain	Start	End	E-Value	Type
BRO1	3	382	1.99e-160	SMART
Pfam:ALIX_LYPXL_bnd	408	702	3.6e-91	PFAM
low complexity region	731	812	N/A	INTRINSIC
Blast:BRO1	813	839	2e-11	BLAST
low complexity region	840	869	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111861
AA Change: D472G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000107492
Gene: ENSMUSG00000032504
AA Change: D472G

Domain	Start	End	E-Value	Type
BRO1	3	387	3.46e-160	SMART
Pfam:ALIX_LYPXL_bnd	417	706	8.8e-96	PFAM
low complexity region	736	817	N/A	INTRINSIC
Blast:BRO1	818	844	2e-11	BLAST
low complexity region	845	874	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135545

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased body and brain size and exhibit structural defects in the epithelium of the choroid plexus and in the brain ependyma that culminate in excessive cell extrusion, enlargement of the lateral ventricles, and hydrocephalus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ccdc102a	T	C	8: 94,908,329	D327G	probably null	Het
Cdh15	G	A	8: 122,856,635	R59H	probably benign	Het
Cfap126	A	G	1: 171,126,131	D134G	possibly damaging	Het
Cript	T	C	17: 87,027,711	L19P	probably benign	Het
Cwf19l1	A	C	19: 44,132,158	L39V	possibly damaging	Het
Eif2b4	T	C	5: 31,191,576		probably null	Het
Esp16	A	G	17: 39,539,847	N39S	probably benign	Het
Fbxo30	A	G	10: 11,290,334	N267D	probably damaging	Het
Gabra6	T	C	11: 42,317,780		probably null	Het
Gp1ba	A	G	11: 70,640,647		probably benign	Het
Klf12	C	T	14: 99,942,067	R279Q	probably benign	Het
Lats1	C	T	10: 7,691,776	Q104*	probably null	Het
Myrfl	A	G	10: 116,839,384	Y215H	possibly damaging	Het
Ncoa1	A	G	12: 4,275,189	I963T	probably damaging	Het
Neurod6	A	G	6: 55,678,921	Y244H	probably damaging	Het
Nodal	T	C	10: 61,418,433	M45T	possibly damaging	Het
Nuggc	A	G	14: 65,624,142	E479G	possibly damaging	Het
Pnmt	C	A	11: 98,386,851	Q74K	probably benign	Het
Slc25a36	G	A	9: 97,079,182	T267I	probably damaging	Het
Slc35e3	A	G	10: 117,744,899	S167P	probably damaging	Het
Sprr2f	C	A	3: 92,366,083	P63H	unknown	Het
Stt3a	T	C	9: 36,748,075	I323V	probably benign	Het
Tedc2	A	G	17: 24,216,384	S344P	probably benign	Het
Unc13b	A	G	4: 43,245,514	D3722G	probably damaging	Het
Zfp35	T	C	18: 24,003,498	Y300H	probably damaging	Het
Zfp959	A	G	17: 55,897,326	D121G	possibly damaging	Het

Other mutations in Pdcd6ip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Pdcd6ip	APN	9	113697518	missense	possibly damaging	0.89
IGL00814:Pdcd6ip	APN	9	113687653	missense	probably damaging	0.97
IGL01092:Pdcd6ip	APN	9	113680181	splice site	probably benign
IGL01621:Pdcd6ip	APN	9	113685422	missense	probably benign	0.03
IGL01781:Pdcd6ip	APN	9	113691498	missense	probably damaging	1.00
IGL02158:Pdcd6ip	APN	9	113680053	nonsense	probably null
IGL03136:Pdcd6ip	APN	9	113691499	missense	probably damaging	1.00
IGL03137:Pdcd6ip	APN	9	113657145	missense	possibly damaging	0.69
IGL03246:Pdcd6ip	APN	9	113678417	missense	possibly damaging	0.93
R0230:Pdcd6ip	UTSW	9	113685293	splice site	probably benign
R0284:Pdcd6ip	UTSW	9	113662504	missense	probably damaging	1.00
R0862:Pdcd6ip	UTSW	9	113674510	splice site	probably benign
R0864:Pdcd6ip	UTSW	9	113674510	splice site	probably benign
R1025:Pdcd6ip	UTSW	9	113662286	missense	probably damaging	1.00
R1687:Pdcd6ip	UTSW	9	113700019	missense	probably damaging	1.00
R1699:Pdcd6ip	UTSW	9	113678354	missense	probably damaging	1.00
R1957:Pdcd6ip	UTSW	9	113708022	missense	probably damaging	1.00
R2698:Pdcd6ip	UTSW	9	113674507	splice site	probably null
R4182:Pdcd6ip	UTSW	9	113700010	missense	probably benign	0.00
R5154:Pdcd6ip	UTSW	9	113691542	missense	probably damaging	1.00
R5229:Pdcd6ip	UTSW	9	113678333	missense	probably damaging	0.99
R5391:Pdcd6ip	UTSW	9	113691518	missense	probably damaging	1.00
R5972:Pdcd6ip	UTSW	9	113662298	missense	probably benign	0.07
R6149:Pdcd6ip	UTSW	9	113659871	missense	probably benign	0.03
R6406:Pdcd6ip	UTSW	9	113674344	missense	possibly damaging	0.81
R6514:Pdcd6ip	UTSW	9	113689694	missense	probably benign	0.43
R6869:Pdcd6ip	UTSW	9	113655106	missense	unknown
R6888:Pdcd6ip	UTSW	9	113671837	missense	probably benign	0.04
R7078:Pdcd6ip	UTSW	9	113659885	missense	probably benign	0.01
R7683:Pdcd6ip	UTSW	9	113687695	missense	probably damaging	1.00
R8260:Pdcd6ip	UTSW	9	113672797	missense	probably benign	0.05
R8376:Pdcd6ip	UTSW	9	113689616	missense	probably damaging	1.00
R8495:Pdcd6ip	UTSW	9	113689707	missense	probably benign	0.23
Z1177:Pdcd6ip	UTSW	9	113685369	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTGGGTGTTCACTATTCATACACAG -3'
(R):5'- CTGTCATGTTGTAACTCAGATTTCTGC -3'

Sequencing Primer
(F):5'- GTGTTCACTATTCATACACAGCTAAG -3'
(R):5'- CTCTACATAGCAAGTTCTGGGCTAG -3'

Posted On

2014-10-30