Incidental Mutation 'R2317:Pnmt'
ID245536
Institutional Source Beutler Lab
Gene Symbol Pnmt
Ensembl Gene ENSMUSG00000038216
Gene Namephenylethanolamine-N-methyltransferase
SynonymsPent
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2317 (G1)
Quality Score187
Status Not validated
Chromosome11
Chromosomal Location98386450-98388181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98386851 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 74 (Q74K)
Ref Sequence ENSEMBL: ENSMUSP00000035549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008021] [ENSMUST00000041301] [ENSMUST00000090827] [ENSMUST00000128897]
Predicted Effect probably benign
Transcript: ENSMUST00000008021
SMART Domains Protein: ENSMUSP00000008021
Gene: ENSMUSG00000007877

DomainStartEndE-ValueType
Pfam:Telethonin 3 167 7.7e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000041218
Predicted Effect probably benign
Transcript: ENSMUST00000041301
AA Change: Q74K

PolyPhen 2 Score 0.265 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035549
Gene: ENSMUSG00000038216
AA Change: Q74K

DomainStartEndE-ValueType
Pfam:NNMT_PNMT_TEMT 25 290 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090827
SMART Domains Protein: ENSMUSP00000088337
Gene: ENSMUSG00000038208

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Per1 54 306 6.3e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128058
Predicted Effect probably benign
Transcript: ENSMUST00000128897
SMART Domains Protein: ENSMUSP00000119668
Gene: ENSMUSG00000038208

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Per1 51 96 6.2e-14 PFAM
Pfam:Per1 93 256 7.3e-59 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene catalyzes the last step of the catecholamine biosynthesis pathway, which methylates norepinephrine to form epinephrine (adrenaline). The enzyme also has beta-carboline 2N-methyltransferase activity. This gene is thought to play a key step in regulating epinephrine production. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous null mice lack adrenal epinephrine and have increased adrenal norepinephrine levels but are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Pnmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8441:Pnmt UTSW 11 98387687 missense probably benign 0.40
R1103:Pnmt UTSW 11 98387676 missense probably benign 0.19
R1420:Pnmt UTSW 11 98387676 missense probably benign 0.19
R4919:Pnmt UTSW 11 98386651 missense probably benign 0.01
R4924:Pnmt UTSW 11 98387460 missense probably damaging 1.00
R6038:Pnmt UTSW 11 98387768 missense probably damaging 1.00
R6038:Pnmt UTSW 11 98387768 missense probably damaging 1.00
V1024:Pnmt UTSW 11 98387687 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGACCTGAAGCACGCTACAG -3'
(R):5'- ATCTTAAACATCCTCCCCTTGAAAG -3'

Sequencing Primer
(F):5'- TACAGGGAGTGGCTCAGACC -3'
(R):5'- GACTCTAAACTGTCTAGTCAGTCATC -3'
Posted On2014-10-30