Incidental Mutation 'R2317:Nuggc'
ID245538
Institutional Source Beutler Lab
Gene Symbol Nuggc
Ensembl Gene ENSMUSG00000061356
Gene Namenuclear GTPase, germinal center associated
SynonymsGm600, SLIP-GC, LOC239151
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location65598546-65648531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65624142 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 479 (E479G)
Ref Sequence ENSEMBL: ENSMUSP00000118402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079469] [ENSMUST00000150897]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079469
AA Change: E495G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078434
Gene: ENSMUSG00000061356
AA Change: E495G

DomainStartEndE-ValueType
Pfam:Dynamin_N 119 372 2.2e-15 PFAM
low complexity region 406 421 N/A INTRINSIC
Blast:AAA 434 739 4e-14 BLAST
coiled coil region 758 792 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000150897
AA Change: E479G

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118402
Gene: ENSMUSG00000061356
AA Change: E479G

DomainStartEndE-ValueType
Pfam:Dynamin_N 103 356 6.1e-16 PFAM
low complexity region 390 405 N/A INTRINSIC
Blast:AAA 418 723 4e-14 BLAST
coiled coil region 742 776 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased somatic mutation frequency immunoglobulin and non-immunoglobulin loci in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Nuggc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Nuggc APN 14 65623207 missense probably damaging 1.00
IGL01403:Nuggc APN 14 65623186 missense probably benign 0.01
IGL01413:Nuggc APN 14 65638581 missense probably benign 0.23
IGL02588:Nuggc APN 14 65617777 splice site probably benign
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0102:Nuggc UTSW 14 65613551 missense probably null 1.00
R0395:Nuggc UTSW 14 65613472 nonsense probably null
R0827:Nuggc UTSW 14 65608891 missense probably damaging 1.00
R1496:Nuggc UTSW 14 65624133 missense probably damaging 0.96
R1861:Nuggc UTSW 14 65642001 splice site probably benign
R1986:Nuggc UTSW 14 65641921 missense probably damaging 0.98
R1995:Nuggc UTSW 14 65611174 missense probably benign 0.02
R2283:Nuggc UTSW 14 65638612 missense possibly damaging 0.89
R3799:Nuggc UTSW 14 65619638 missense probably benign 0.00
R3980:Nuggc UTSW 14 65619093 critical splice donor site probably null
R4303:Nuggc UTSW 14 65611172 missense possibly damaging 0.77
R4431:Nuggc UTSW 14 65611210 missense probably benign 0.19
R4734:Nuggc UTSW 14 65623230 missense probably damaging 1.00
R5095:Nuggc UTSW 14 65635090 nonsense probably null
R5108:Nuggc UTSW 14 65638680 missense probably damaging 0.99
R5360:Nuggc UTSW 14 65638626 missense probably damaging 1.00
R5547:Nuggc UTSW 14 65641881 missense possibly damaging 0.87
R5636:Nuggc UTSW 14 65648188 nonsense probably null
R6494:Nuggc UTSW 14 65648222 missense probably damaging 1.00
R6922:Nuggc UTSW 14 65617643 missense probably damaging 1.00
R6971:Nuggc UTSW 14 65608856 missense probably benign 0.04
R7124:Nuggc UTSW 14 65608802 missense probably damaging 1.00
R7273:Nuggc UTSW 14 65619608 missense probably damaging 0.99
R7282:Nuggc UTSW 14 65617623 missense probably damaging 1.00
R7578:Nuggc UTSW 14 65648174 missense probably damaging 1.00
R7670:Nuggc UTSW 14 65613526 missense probably damaging 1.00
R7780:Nuggc UTSW 14 65645041 missense probably damaging 1.00
R7871:Nuggc UTSW 14 65623251 missense probably benign 0.01
R7954:Nuggc UTSW 14 65623251 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCAACTGTTTCATTGACTTCC -3'
(R):5'- TCCTAACTTACAGTTGCACAGG -3'

Sequencing Primer
(F):5'- CAACTGTTTCATTGACTTCCTTTATG -3'
(R):5'- GTGAGACAACCCAGGAGCCTTC -3'
Posted On2014-10-30