Incidental Mutation 'R2317:Klf12'
ID245539
Institutional Source Beutler Lab
Gene Symbol Klf12
Ensembl Gene ENSMUSG00000072294
Gene NameKruppel-like factor 12
Synonyms2700063E05Rik, D530033K05Rik, AP-2rep, B130052C06Rik
MMRRC Submission 040312-MU
Accession Numbers

Ncbi RefSeq: NM_010636.3; MGI:1333796

Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location99870632-100284679 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 99942067 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 279 (R279Q)
Ref Sequence ENSEMBL: ENSMUSP00000153901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097079] [ENSMUST00000228216]
Predicted Effect probably benign
Transcript: ENSMUST00000097079
AA Change: R279Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000094844
Gene: ENSMUSG00000072294
AA Change: R279Q

DomainStartEndE-ValueType
low complexity region 89 145 N/A INTRINSIC
low complexity region 183 200 N/A INTRINSIC
ZnF_C2H2 317 341 9.58e-3 SMART
ZnF_C2H2 347 371 8.6e-5 SMART
ZnF_C2H2 377 399 9.58e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226205
Predicted Effect probably benign
Transcript: ENSMUST00000228216
AA Change: R279Q

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activator protein-2 alpha (AP-2 alpha) is a developmentally-regulated transcription factor and important regulator of gene expression during vertebrate development and carcinogenesis. The protein encoded by this gene is a member of the Kruppel-like zinc finger protein family and can repress expression of the AP-2 alpha gene by binding to a specific site in the AP-2 alpha gene promoter. Repression by the encoded protein requires binding with a corepressor, CtBP1. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(49) : Targeted(1) Gene trapped(48)

Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp35 T C 18: 24,003,498 Y300H probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Klf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01392:Klf12 APN 14 100149757 missense probably damaging 0.99
IGL01407:Klf12 APN 14 100109858 missense possibly damaging 0.72
IGL01621:Klf12 APN 14 100023149 missense probably damaging 1.00
IGL02746:Klf12 APN 14 99900220 missense probably benign 0.17
IGL02839:Klf12 APN 14 99900239 nonsense probably null
R0034:Klf12 UTSW 14 99987429 critical splice donor site probably null
R0034:Klf12 UTSW 14 99987429 critical splice donor site probably null
R0212:Klf12 UTSW 14 100022862 missense probably benign
R0577:Klf12 UTSW 14 100023149 missense probably damaging 0.99
R1980:Klf12 UTSW 14 100149726 splice site probably null
R2017:Klf12 UTSW 14 100022637 missense possibly damaging 0.87
R2282:Klf12 UTSW 14 99900145 missense probably damaging 0.96
R2901:Klf12 UTSW 14 99900146 missense probably damaging 0.98
R4946:Klf12 UTSW 14 100022957 missense possibly damaging 0.53
R5386:Klf12 UTSW 14 99900159 missense probably damaging 1.00
R5802:Klf12 UTSW 14 100022894 missense probably benign 0.33
R5903:Klf12 UTSW 14 100022688 missense probably damaging 0.99
R6037:Klf12 UTSW 14 99900214 missense probably benign 0.17
R6037:Klf12 UTSW 14 99900214 missense probably benign 0.17
R6753:Klf12 UTSW 14 100109776 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTGCAGAGTAATTCCATCAGC -3'
(R):5'- ATGTGTGGCACCTTGGTACC -3'

Sequencing Primer
(F):5'- CTGCAGAGTAATTCCATCAGCATTTG -3'
(R):5'- GGCCCTGGAATTTAATTAATTGCACC -3'
Posted On2014-10-30