Incidental Mutation 'R2317:Zfp35'
ID245544
Institutional Source Beutler Lab
Gene Symbol Zfp35
Ensembl Gene ENSMUSG00000063281
Gene Namezinc finger protein 35
SynonymsZfp-35
MMRRC Submission 040312-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R2317 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location23989632-24005376 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24003498 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 300 (Y300H)
Ref Sequence ENSEMBL: ENSMUSP00000074475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074941]
Predicted Effect probably damaging
Transcript: ENSMUST00000074941
AA Change: Y300H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074475
Gene: ENSMUSG00000063281
AA Change: Y300H

DomainStartEndE-ValueType
ZnF_C2H2 78 100 1.28e-3 SMART
ZnF_C2H2 104 126 8.47e-4 SMART
ZnF_C2H2 132 154 5.21e-4 SMART
ZnF_C2H2 160 182 1.84e-4 SMART
ZnF_C2H2 188 210 7.37e-4 SMART
ZnF_C2H2 216 238 4.72e-2 SMART
ZnF_C2H2 244 266 2.4e-3 SMART
ZnF_C2H2 272 294 1.04e-3 SMART
ZnF_C2H2 300 322 3.69e-4 SMART
ZnF_C2H2 328 350 5.21e-4 SMART
ZnF_C2H2 356 378 1.5e-4 SMART
ZnF_C2H2 384 406 1.6e-4 SMART
ZnF_C2H2 412 434 3.89e-3 SMART
ZnF_C2H2 440 462 1.72e-4 SMART
ZnF_C2H2 468 490 2.71e-2 SMART
ZnF_C2H2 496 518 1.6e-4 SMART
ZnF_C2H2 524 545 2.17e1 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out mutation exhibit increased airway responsiveness to ovalbumin and methacholine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc102a T C 8: 94,908,329 D327G probably null Het
Cdh15 G A 8: 122,856,635 R59H probably benign Het
Cfap126 A G 1: 171,126,131 D134G possibly damaging Het
Cript T C 17: 87,027,711 L19P probably benign Het
Cwf19l1 A C 19: 44,132,158 L39V possibly damaging Het
Eif2b4 T C 5: 31,191,576 probably null Het
Esp16 A G 17: 39,539,847 N39S probably benign Het
Fbxo30 A G 10: 11,290,334 N267D probably damaging Het
Gabra6 T C 11: 42,317,780 probably null Het
Gp1ba A G 11: 70,640,647 probably benign Het
Klf12 C T 14: 99,942,067 R279Q probably benign Het
Lats1 C T 10: 7,691,776 Q104* probably null Het
Myrfl A G 10: 116,839,384 Y215H possibly damaging Het
Ncoa1 A G 12: 4,275,189 I963T probably damaging Het
Neurod6 A G 6: 55,678,921 Y244H probably damaging Het
Nodal T C 10: 61,418,433 M45T possibly damaging Het
Nuggc A G 14: 65,624,142 E479G possibly damaging Het
Pdcd6ip T C 9: 113,672,774 D467G probably benign Het
Pnmt C A 11: 98,386,851 Q74K probably benign Het
Slc25a36 G A 9: 97,079,182 T267I probably damaging Het
Slc35e3 A G 10: 117,744,899 S167P probably damaging Het
Sprr2f C A 3: 92,366,083 P63H unknown Het
Stt3a T C 9: 36,748,075 I323V probably benign Het
Tedc2 A G 17: 24,216,384 S344P probably benign Het
Unc13b A G 4: 43,245,514 D3722G probably damaging Het
Zfp959 A G 17: 55,897,326 D121G possibly damaging Het
Other mutations in Zfp35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0012:Zfp35 UTSW 18 24002944 missense probably benign 0.01
R1453:Zfp35 UTSW 18 24003500 nonsense probably null
R1807:Zfp35 UTSW 18 24003929 missense probably benign 0.28
R2863:Zfp35 UTSW 18 24004295 missense probably damaging 0.99
R3080:Zfp35 UTSW 18 24003310 missense probably damaging 0.99
R3756:Zfp35 UTSW 18 24002925 missense possibly damaging 0.88
R4114:Zfp35 UTSW 18 24002709 missense probably benign 0.08
R4222:Zfp35 UTSW 18 24003189 missense possibly damaging 0.91
R4780:Zfp35 UTSW 18 24003269 missense probably damaging 1.00
R5137:Zfp35 UTSW 18 24004137 nonsense probably null
R5261:Zfp35 UTSW 18 24003721 missense probably damaging 0.98
R5375:Zfp35 UTSW 18 24002916 missense possibly damaging 0.83
R6001:Zfp35 UTSW 18 24002759 missense probably benign
R6190:Zfp35 UTSW 18 24004061 missense probably benign 0.00
R6774:Zfp35 UTSW 18 24002958 missense possibly damaging 0.51
R6850:Zfp35 UTSW 18 24002782 missense possibly damaging 0.76
R6979:Zfp35 UTSW 18 24003870 missense probably benign 0.32
R7029:Zfp35 UTSW 18 24003526 missense probably damaging 0.98
R7079:Zfp35 UTSW 18 24003300 missense possibly damaging 0.89
R7858:Zfp35 UTSW 18 24003840 missense probably damaging 1.00
R7941:Zfp35 UTSW 18 24003840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTCAGGCATGGTTAAAC -3'
(R):5'- AGGTTGGAACTCTGACTGAAAG -3'

Sequencing Primer
(F):5'- GCACTCAGGCATGGTTAAACATCTG -3'
(R):5'- CACTGACTACATGGGTAAGGCTTC -3'
Posted On2014-10-30