Incidental Mutation 'R2318:Col4a3'

• ID: 245546
• Institutional Source: Beutler Lab
• Gene Symbol: Col4a3
• Ensembl Gene: ENSMUSG00000079465
• Gene Name: collagen, type IV, alpha 3
• Synonyms: alpha3(IV), tumstatin
• Essential gene?: Non essential (E-score: 0.000)
• Stock #: R2318 (G1)
• Quality Score: 225
• Status: Not validated
• Chromosome: 1
• Chromosomal Location: 82586921-82722059 bp(+) (GRCm38)
• Type of Mutation: splice site
• DNA Base Change (assembly): T to A at 82648569 bp (GRCm38)
• Zygosity: Heterozygous
• Ref Sequence: ENSEMBL: ENSMUSP00000109084
• Gene Model: predicted gene model for transcript(s): [ENSMUST00000113457]
• AlphaFold: Q9QZS0
• Predicted Effect: probably null; Transcript: ENSMUST00000113457
• SMART Domains: Protein: ENSMUSP00000109084; Gene: ENSMUSG00000079465

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Collagen	41	102	9.6e-11	PFAM
Pfam:Collagen	97	164	3.6e-11	PFAM
Pfam:Collagen	164	223	3.6e-9	PFAM
low complexity region	233	243	N/A	INTRINSIC
Pfam:Collagen	284	344	2.4e-10	PFAM
low complexity region	368	393	N/A	INTRINSIC
Pfam:Collagen	415	477	5e-10	PFAM
Pfam:Collagen	481	545	1e-9	PFAM
low complexity region	550	585	N/A	INTRINSIC
Pfam:Collagen	588	653	8.9e-9	PFAM
Pfam:Collagen	682	744	1.1e-8	PFAM
Pfam:Collagen	743	807	6.9e-10	PFAM
Pfam:Collagen	786	847	1.5e-8	PFAM
Pfam:Collagen	845	904	1.5e-10	PFAM
Pfam:Collagen	887	946	4.1e-10	PFAM
Pfam:Collagen	948	1006	8.1e-11	PFAM
Pfam:Collagen	997	1061	2.8e-10	PFAM
Pfam:Collagen	1057	1120	2.5e-10	PFAM
Pfam:Collagen	1114	1176	1.7e-9	PFAM
Pfam:Collagen	1174	1233	1.1e-9	PFAM
Pfam:Collagen	1232	1295	6.9e-9	PFAM
low complexity region	1326	1347	N/A	INTRINSIC
Pfam:Collagen	1377	1439	4.9e-11	PFAM
C4	1444	1553	3.77e-70	SMART
C4	1554	1667	3.28e-70	SMART

• Coding Region Coverage:
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
• MGI Phenotype: FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010] ; PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
• Posted On: 2014-10-30

Predicted Primers

PCR Primer
(F):5'- GTGAATCAGTATGCCTGGGAGG -3'
(R):5'- GTTGGCATCCCTGTTCTCAGAC -3'

Sequencing Primer
(F):5'- GAGACTTTCTTACTTGCAGCAAGC -3'
(R):5'- GGCATCCCTGTTCTCAGACTCTATC -3'