Incidental Mutation 'R2318:Col4a3'
ID 245546
Institutional Source Beutler Lab
Gene Symbol Col4a3
Ensembl Gene ENSMUSG00000079465
Gene Name collagen, type IV, alpha 3
Synonyms alpha3(IV), tumstatin
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2318 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 82586921-82722059 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 82648569 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109084 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113457]
AlphaFold Q9QZS0
Predicted Effect probably null
Transcript: ENSMUST00000113457
SMART Domains Protein: ENSMUSP00000109084
Gene: ENSMUSG00000079465

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 41 102 9.6e-11 PFAM
Pfam:Collagen 97 164 3.6e-11 PFAM
Pfam:Collagen 164 223 3.6e-9 PFAM
low complexity region 233 243 N/A INTRINSIC
Pfam:Collagen 284 344 2.4e-10 PFAM
low complexity region 368 393 N/A INTRINSIC
Pfam:Collagen 415 477 5e-10 PFAM
Pfam:Collagen 481 545 1e-9 PFAM
low complexity region 550 585 N/A INTRINSIC
Pfam:Collagen 588 653 8.9e-9 PFAM
Pfam:Collagen 682 744 1.1e-8 PFAM
Pfam:Collagen 743 807 6.9e-10 PFAM
Pfam:Collagen 786 847 1.5e-8 PFAM
Pfam:Collagen 845 904 1.5e-10 PFAM
Pfam:Collagen 887 946 4.1e-10 PFAM
Pfam:Collagen 948 1006 8.1e-11 PFAM
Pfam:Collagen 997 1061 2.8e-10 PFAM
Pfam:Collagen 1057 1120 2.5e-10 PFAM
Pfam:Collagen 1114 1176 1.7e-9 PFAM
Pfam:Collagen 1174 1233 1.1e-9 PFAM
Pfam:Collagen 1232 1295 6.9e-9 PFAM
low complexity region 1326 1347 N/A INTRINSIC
Pfam:Collagen 1377 1439 4.9e-11 PFAM
C4 1444 1553 3.77e-70 SMART
C4 1554 1667 3.28e-70 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Type IV collagen, the major structural component of basement membranes, is a multimeric protein composed of 3 alpha subunits. These subunits are encoded by 6 different genes, alpha 1 through alpha 6, each of which can form a triple helix structure with 2 other subunits to form type IV collagen. This gene encodes alpha 3. In the Goodpasture syndrome, autoantibodies bind to the collagen molecules in the basement membranes of alveoli and glomeruli. The epitopes that elicit these autoantibodies are localized largely to the non-collagenous C-terminal domain of the protein. A specific kinase phosphorylates amino acids in this same C-terminal region and the expression of this kinase is upregulated during pathogenesis. This gene is also linked to an autosomal recessive form of Alport syndrome. The mutations contributing to this syndrome are also located within the exons that encode this C-terminal region. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. [provided by RefSeq, Jun 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit renal pathology including reduced glomerular filtration, impaired glomerular integrity, and glomerulonephrosis, resulting in uremia, proteinuria, and high mortality in young adults. Auditory thresholds aremildly increased across all test frequencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 (GRCm38) Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 (GRCm38) A41T probably damaging Het
Car15 T C 16: 17,836,599 (GRCm38) M158V probably benign Het
Cinp C A 12: 110,874,009 (GRCm38) W113L probably damaging Het
Csnk2b T C 17: 35,118,061 (GRCm38) Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 (GRCm38) R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 (GRCm38) F876L possibly damaging Het
F11 A G 8: 45,248,638 (GRCm38) S353P probably damaging Het
Gm5868 T C 5: 72,586,295 (GRCm38) T27A probably benign Het
Hist1h4d A G 13: 23,581,756 (GRCm38) Y52C probably damaging Het
Mast1 T C 8: 84,921,125 (GRCm38) D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 (GRCm38) V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 (GRCm38) R827* probably null Het
Nlrp9a G A 7: 26,573,852 (GRCm38) V860M probably damaging Het
Plod3 G C 5: 136,988,146 (GRCm38) A50P probably benign Het
Prr14l T C 5: 32,830,078 (GRCm38) E691G probably benign Het
Rad1 A G 15: 10,490,409 (GRCm38) N154S probably benign Het
Smc2 T C 4: 52,446,030 (GRCm38) S133P probably damaging Het
Sstr1 T A 12: 58,212,776 (GRCm38) S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 (GRCm38) Y766C probably damaging Het
Timm44 A G 8: 4,268,307 (GRCm38) V129A probably benign Het
Tinag T C 9: 77,045,411 (GRCm38) Y97C probably damaging Het
Tns2 C T 15: 102,108,934 (GRCm38) R281C probably damaging Het
Ubap2 A G 4: 41,251,542 (GRCm38) V30A probably damaging Het
Other mutations in Col4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Col4a3 APN 1 82,697,754 (GRCm38) missense unknown
IGL00847:Col4a3 APN 1 82,717,869 (GRCm38) missense probably damaging 1.00
IGL01011:Col4a3 APN 1 82,682,301 (GRCm38) missense unknown
IGL01102:Col4a3 APN 1 82,670,255 (GRCm38) missense unknown
IGL01102:Col4a3 APN 1 82,669,720 (GRCm38) missense unknown
IGL02071:Col4a3 APN 1 82,660,887 (GRCm38) critical splice donor site probably null
IGL02244:Col4a3 APN 1 82,669,771 (GRCm38) splice site probably benign
IGL02380:Col4a3 APN 1 82,672,788 (GRCm38) splice site probably benign
IGL02431:Col4a3 APN 1 82,679,623 (GRCm38) nonsense probably null
IGL02466:Col4a3 APN 1 82,670,192 (GRCm38) missense unknown
IGL02694:Col4a3 APN 1 82,710,794 (GRCm38) unclassified probably benign
IGL02709:Col4a3 APN 1 82,679,112 (GRCm38) missense unknown
IGL02752:Col4a3 APN 1 82,660,225 (GRCm38) missense unknown
IGL02792:Col4a3 APN 1 82,718,803 (GRCm38) missense probably damaging 1.00
IGL03203:Col4a3 APN 1 82,672,639 (GRCm38) nonsense probably null
IGL03218:Col4a3 APN 1 82,643,206 (GRCm38) splice site probably benign
FR4976:Col4a3 UTSW 1 82,718,906 (GRCm38) frame shift probably null
PIT4260001:Col4a3 UTSW 1 82,682,761 (GRCm38) missense unknown
PIT4515001:Col4a3 UTSW 1 82,682,303 (GRCm38) missense unknown
R0035:Col4a3 UTSW 1 82,672,753 (GRCm38) missense unknown
R0099:Col4a3 UTSW 1 82,717,993 (GRCm38) missense probably benign 0.41
R0433:Col4a3 UTSW 1 82,670,219 (GRCm38) missense unknown
R0573:Col4a3 UTSW 1 82,716,363 (GRCm38) missense possibly damaging 0.83
R0606:Col4a3 UTSW 1 82,672,586 (GRCm38) splice site probably benign
R0715:Col4a3 UTSW 1 82,652,158 (GRCm38) splice site probably benign
R0961:Col4a3 UTSW 1 82,708,576 (GRCm38) splice site probably benign
R1257:Col4a3 UTSW 1 82,716,365 (GRCm38) missense probably damaging 1.00
R1264:Col4a3 UTSW 1 82,643,301 (GRCm38) splice site probably benign
R1373:Col4a3 UTSW 1 82,690,087 (GRCm38) splice site probably benign
R1694:Col4a3 UTSW 1 82,690,663 (GRCm38) splice site probably null
R1895:Col4a3 UTSW 1 82,679,108 (GRCm38) missense unknown
R1925:Col4a3 UTSW 1 82,711,874 (GRCm38) unclassified probably benign
R1925:Col4a3 UTSW 1 82,700,373 (GRCm38) missense unknown
R2033:Col4a3 UTSW 1 82,718,011 (GRCm38) intron probably benign
R2044:Col4a3 UTSW 1 82,696,319 (GRCm38) missense unknown
R2122:Col4a3 UTSW 1 82,654,957 (GRCm38) missense unknown
R2282:Col4a3 UTSW 1 82,708,638 (GRCm38) missense unknown
R2421:Col4a3 UTSW 1 82,670,275 (GRCm38) splice site probably benign
R2517:Col4a3 UTSW 1 82,680,710 (GRCm38) missense unknown
R2965:Col4a3 UTSW 1 82,648,600 (GRCm38) missense unknown
R3085:Col4a3 UTSW 1 82,651,258 (GRCm38) missense unknown
R3150:Col4a3 UTSW 1 82,657,137 (GRCm38) splice site probably null
R3947:Col4a3 UTSW 1 82,715,332 (GRCm38) missense probably damaging 1.00
R4756:Col4a3 UTSW 1 82,716,297 (GRCm38) critical splice acceptor site probably null
R4910:Col4a3 UTSW 1 82,672,679 (GRCm38) missense unknown
R4928:Col4a3 UTSW 1 82,710,977 (GRCm38) unclassified probably benign
R5044:Col4a3 UTSW 1 82,666,546 (GRCm38) missense unknown
R5557:Col4a3 UTSW 1 82,715,247 (GRCm38) unclassified probably benign
R5761:Col4a3 UTSW 1 82,716,057 (GRCm38) nonsense probably null
R5970:Col4a3 UTSW 1 82,716,329 (GRCm38) missense possibly damaging 0.76
R6576:Col4a3 UTSW 1 82,708,574 (GRCm38) splice site probably null
R6583:Col4a3 UTSW 1 82,641,476 (GRCm38) missense unknown
R6675:Col4a3 UTSW 1 82,668,925 (GRCm38) missense unknown
R7170:Col4a3 UTSW 1 82,715,909 (GRCm38) splice site probably null
R7592:Col4a3 UTSW 1 82,648,617 (GRCm38) missense unknown
R7624:Col4a3 UTSW 1 82,718,884 (GRCm38) missense probably benign
R7994:Col4a3 UTSW 1 82,662,906 (GRCm38) missense unknown
R8127:Col4a3 UTSW 1 82,649,760 (GRCm38) missense unknown
R8702:Col4a3 UTSW 1 82,710,979 (GRCm38) missense unknown
R8865:Col4a3 UTSW 1 82,669,762 (GRCm38) critical splice donor site probably null
R8973:Col4a3 UTSW 1 82,715,331 (GRCm38) missense probably benign 0.11
R9611:Col4a3 UTSW 1 82,700,297 (GRCm38) missense unknown
R9665:Col4a3 UTSW 1 82,690,580 (GRCm38) missense unknown
R9765:Col4a3 UTSW 1 82,668,957 (GRCm38) nonsense probably null
X0067:Col4a3 UTSW 1 82,716,159 (GRCm38) missense probably damaging 0.99
Z1177:Col4a3 UTSW 1 82,690,039 (GRCm38) missense unknown
Predicted Primers PCR Primer
(F):5'- GTGAATCAGTATGCCTGGGAGG -3'
(R):5'- GTTGGCATCCCTGTTCTCAGAC -3'

Sequencing Primer
(F):5'- GAGACTTTCTTACTTGCAGCAAGC -3'
(R):5'- GGCATCCCTGTTCTCAGACTCTATC -3'
Posted On 2014-10-30