Mutagenetix > Incidental Mutations

Incidental Mutation 'R2318:Ubap2'

245547

Institutional Source

Beutler Lab

Gene Symbol

Ubap2

Ensembl Gene

ENSMUSG00000028433

Gene Name

ubiquitin-associated protein 2

Synonyms

1190005K07Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

R2318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41194313-41275144 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41251542 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 30 (V30A)

Ref Sequence

ENSEMBL: ENSMUSP00000103703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030143
AA Change: V31A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: V31A

Domain	Start	End	E-Value	Type
UBA	53	91	9.62e-8	SMART
low complexity region	115	127	N/A	INTRINSIC
low complexity region	130	144	N/A	INTRINSIC
low complexity region	166	185	N/A	INTRINSIC
low complexity region	256	266	N/A	INTRINSIC
low complexity region	341	358	N/A	INTRINSIC
low complexity region	436	448	N/A	INTRINSIC
Pfam:DUF3697	512	544	1.5e-18	PFAM
low complexity region	583	618	N/A	INTRINSIC
low complexity region	631	644	N/A	INTRINSIC
low complexity region	696	722	N/A	INTRINSIC
low complexity region	744	768	N/A	INTRINSIC
low complexity region	787	800	N/A	INTRINSIC
low complexity region	888	914	N/A	INTRINSIC
low complexity region	1007	1024	N/A	INTRINSIC
low complexity region	1057	1078	N/A	INTRINSIC
low complexity region	1084	1098	N/A	INTRINSIC
low complexity region	1101	1115	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000108068
AA Change: V30A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: V30A

Domain	Start	End	E-Value	Type
UBA	52	90	9.62e-8	SMART
low complexity region	114	126	N/A	INTRINSIC
low complexity region	129	143	N/A	INTRINSIC
low complexity region	165	184	N/A	INTRINSIC
low complexity region	255	265	N/A	INTRINSIC
low complexity region	340	357	N/A	INTRINSIC
low complexity region	435	447	N/A	INTRINSIC
Pfam:DUF3697	511	543	1.2e-20	PFAM
low complexity region	582	617	N/A	INTRINSIC
low complexity region	630	643	N/A	INTRINSIC
low complexity region	695	721	N/A	INTRINSIC
low complexity region	743	767	N/A	INTRINSIC
low complexity region	786	799	N/A	INTRINSIC
low complexity region	887	913	N/A	INTRINSIC
low complexity region	1006	1023	N/A	INTRINSIC
low complexity region	1056	1077	N/A	INTRINSIC
low complexity region	1083	1097	N/A	INTRINSIC
low complexity region	1100	1114	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118435

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132499

Predicted Effect

unknown
Transcript: ENSMUST00000134782
AA Change: W26R

SMART Domains

Protein: ENSMUSP00000121724
Gene: ENSMUSG00000028433
AA Change: W26R

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
UBA	61	99	9.62e-8	SMART
low complexity region	123	135	N/A	INTRINSIC
low complexity region	138	152	N/A	INTRINSIC
low complexity region	174	193	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,588,701	Y66H	probably damaging	Het
Arhgef10	G	A	8: 14,928,855	A41T	probably damaging	Het
Car15	T	C	16: 17,836,599	M158V	probably benign	Het
Cinp	C	A	12: 110,874,009	W113L	probably damaging	Het
Col4a3	T	A	1: 82,648,569		probably null	Het
Csnk2b	T	C	17: 35,118,061	Y101C	possibly damaging	Het
Ddb1	C	T	19: 10,626,628	R900C	probably damaging	Het
Eif4g2	A	G	7: 111,073,858	F876L	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Gm5868	T	C	5: 72,586,295	T27A	probably benign	Het
Hist1h4d	A	G	13: 23,581,756	Y52C	probably damaging	Het
Mast1	T	C	8: 84,921,125	D540G	probably damaging	Het
Mis18bp1	C	T	12: 65,140,843	V829M	possibly damaging	Het
Mtus2	C	T	5: 148,107,082	R827*	probably null	Het
Nlrp9a	G	A	7: 26,573,852	V860M	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prr14l	T	C	5: 32,830,078	E691G	probably benign	Het
Rad1	A	G	15: 10,490,409	N154S	probably benign	Het
Smc2	T	C	4: 52,446,030	S133P	probably damaging	Het
Sstr1	T	A	12: 58,212,776	S62T	possibly damaging	Het
Thsd7a	T	C	6: 12,405,147	Y766C	probably damaging	Het
Timm44	A	G	8: 4,268,307	V129A	probably benign	Het
Tinag	T	C	9: 77,045,411	Y97C	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het

Other mutations in Ubap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Ubap2	APN	4	41195328	splice site	probably benign
IGL01109:Ubap2	APN	4	41195155	missense	probably damaging	1.00
IGL01354:Ubap2	APN	4	41207005	missense	probably damaging	1.00
IGL01563:Ubap2	APN	4	41195998	missense	probably damaging	0.96
IGL01602:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01605:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01688:Ubap2	APN	4	41226308	missense	probably benign
IGL01733:Ubap2	APN	4	41195862	unclassified	probably benign
IGL01896:Ubap2	APN	4	41202362	missense	possibly damaging	0.85
IGL01942:Ubap2	APN	4	41251608	missense	probably benign	0.00
IGL02095:Ubap2	APN	4	41229709	missense	probably benign
R0608:Ubap2	UTSW	4	41218319	missense	probably benign	0.10
R0938:Ubap2	UTSW	4	41202304	missense	probably damaging	1.00
R1449:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R1484:Ubap2	UTSW	4	41235593	missense	probably damaging	1.00
R1548:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1549:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1604:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1607:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1739:Ubap2	UTSW	4	41206849	missense	probably benign	0.00
R1772:Ubap2	UTSW	4	41202380	missense	probably benign	0.02
R1862:Ubap2	UTSW	4	41221607	missense	probably benign
R1869:Ubap2	UTSW	4	41233617	missense	probably damaging	1.00
R1886:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1887:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2063:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2064:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2065:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2066:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2095:Ubap2	UTSW	4	41206901	missense	possibly damaging	0.68
R2214:Ubap2	UTSW	4	41199714	critical splice donor site	probably null
R2215:Ubap2	UTSW	4	41196483	splice site	probably null
R3755:Ubap2	UTSW	4	41195482	missense	probably damaging	1.00
R4620:Ubap2	UTSW	4	41233698	missense	probably damaging	1.00
R4717:Ubap2	UTSW	4	41218333	missense	possibly damaging	0.93
R4756:Ubap2	UTSW	4	41211771	missense	probably damaging	1.00
R4942:Ubap2	UTSW	4	41245461	intron	probably benign
R5344:Ubap2	UTSW	4	41251578	missense	possibly damaging	0.46
R5763:Ubap2	UTSW	4	41195809	missense	probably damaging	1.00
R5851:Ubap2	UTSW	4	41206268	nonsense	probably null
R5951:Ubap2	UTSW	4	41205753	splice site	probably null
R6178:Ubap2	UTSW	4	41206981	missense	probably benign
R6489:Ubap2	UTSW	4	41203574	critical splice acceptor site	probably null
R6520:Ubap2	UTSW	4	41195155	missense	probably damaging	1.00
R6652:Ubap2	UTSW	4	41196743	missense	possibly damaging	0.68
R6702:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227224	small insertion	probably benign
R6860:Ubap2	UTSW	4	41233631	missense	probably damaging	1.00
R7007:Ubap2	UTSW	4	41206221	missense	probably damaging	0.97
R7048:Ubap2	UTSW	4	41196033	missense	possibly damaging	0.49
R7121:Ubap2	UTSW	4	41205550	missense	probably benign	0.00
R7371:Ubap2	UTSW	4	41195779	missense	probably benign	0.16
R7378:Ubap2	UTSW	4	41235515	critical splice donor site	probably null
R7695:Ubap2	UTSW	4	41211740	missense	probably damaging	0.98
R7811:Ubap2	UTSW	4	41211710	missense	probably benign	0.22
R7828:Ubap2	UTSW	4	41221615	missense	probably benign	0.00
R7838:Ubap2	UTSW	4	41233655	missense	probably damaging	1.00
R8016:Ubap2	UTSW	4	41195201	missense	possibly damaging	0.91
R8790:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R8817:Ubap2	UTSW	4	41223425	missense	possibly damaging	0.66
X0061:Ubap2	UTSW	4	41196507	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGGAATTCGGAACTACACAATG -3'
(R):5'- CCCACTCCCCGAATTAGATG -3'

Sequencing Primer
(F):5'- TCGGAACTACACAATGATTCTCCTGG -3'
(R):5'- GTTTTGCTCACAATGCCT -3'

Posted On

2014-10-30