Incidental Mutation 'R2318:Smc2'
ID245548
Institutional Source Beutler Lab
Gene Symbol Smc2
Ensembl Gene ENSMUSG00000028312
Gene Namestructural maintenance of chromosomes 2
SynonymsCAP-E, Fin16, 5730502P04Rik, Smc2l1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R2318 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location52439243-52488260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52446030 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 133 (S133P)
Ref Sequence ENSEMBL: ENSMUSP00000114228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102915] [ENSMUST00000117280] [ENSMUST00000142227]
Predicted Effect probably damaging
Transcript: ENSMUST00000102915
AA Change: S133P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099979
Gene: ENSMUSG00000028312
AA Change: S133P

DomainStartEndE-ValueType
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117280
AA Change: S133P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113940
Gene: ENSMUSG00000028312
AA Change: S133P

DomainStartEndE-ValueType
Pfam:AAA_21 27 131 3.8e-6 PFAM
internal_repeat_1 146 174 2.4e-6 PROSPERO
low complexity region 183 207 N/A INTRINSIC
coiled coil region 238 355 N/A INTRINSIC
coiled coil region 400 503 N/A INTRINSIC
SMC_hinge 520 640 3.8e-34 SMART
coiled coil region 676 880 N/A INTRINSIC
coiled coil region 984 1031 N/A INTRINSIC
PDB:4I99|B 1034 1186 3e-15 PDB
SCOP:d1e69a_ 1066 1144 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131163
Predicted Effect probably damaging
Transcript: ENSMUST00000142227
AA Change: S133P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114228
Gene: ENSMUSG00000028312
AA Change: S133P

DomainStartEndE-ValueType
Pfam:SMC_N 2 351 2.3e-36 PFAM
Pfam:AAA_21 27 131 1.7e-8 PFAM
coiled coil region 400 471 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146787
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of both condensin I and condensin II complexes, and forms a heterodimer with structural maintenance of chromosome 4 (Smc4). This heterodimer is the catalytic subunit for both condensin complexes, and is involved in several processes, including chromosome condensation during mitosis and meiosis, cohesin removal during mitosis and meiosis, and single-strand break (SSB) repair. Reduced expression of this gene results in chromosome segregation defects during mitosis and meiosis, with a more severe defect observed in embryonic stem cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice die embryonically. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Smc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Smc2 APN 4 52450842 missense probably damaging 1.00
IGL02045:Smc2 APN 4 52462914 missense probably benign 0.01
IGL03013:Smc2 APN 4 52442280 missense probably damaging 1.00
IGL03031:Smc2 APN 4 52449638 missense probably benign 0.35
IGL03246:Smc2 APN 4 52440301 nonsense probably null
Janitor UTSW 4 52478448 missense probably damaging 1.00
R0539:Smc2 UTSW 4 52458558 missense probably benign 0.01
R0782:Smc2 UTSW 4 52469799 missense probably benign 0.30
R1908:Smc2 UTSW 4 52450863 missense probably damaging 0.97
R2054:Smc2 UTSW 4 52462948 missense probably benign 0.00
R2109:Smc2 UTSW 4 52474987 missense probably benign 0.00
R2352:Smc2 UTSW 4 52460266 missense probably benign
R3418:Smc2 UTSW 4 52476850 splice site probably benign
R4003:Smc2 UTSW 4 52462897 missense probably damaging 1.00
R4133:Smc2 UTSW 4 52450947 missense probably damaging 0.99
R4299:Smc2 UTSW 4 52440238 utr 5 prime probably benign
R4547:Smc2 UTSW 4 52467866 missense probably benign 0.09
R4787:Smc2 UTSW 4 52462927 missense probably damaging 0.98
R4816:Smc2 UTSW 4 52451231 missense probably benign 0.00
R4829:Smc2 UTSW 4 52449612 missense probably damaging 0.98
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4861:Smc2 UTSW 4 52461090 missense probably benign 0.14
R4951:Smc2 UTSW 4 52462926 missense possibly damaging 0.95
R4963:Smc2 UTSW 4 52450826 missense probably damaging 1.00
R4996:Smc2 UTSW 4 52461042 splice site probably null
R5028:Smc2 UTSW 4 52458447 missense probably damaging 0.96
R5103:Smc2 UTSW 4 52459033 missense probably damaging 1.00
R5159:Smc2 UTSW 4 52460181 missense possibly damaging 0.65
R5387:Smc2 UTSW 4 52475096 missense probably benign 0.16
R5697:Smc2 UTSW 4 52459045 missense probably benign 0.01
R6006:Smc2 UTSW 4 52459024 missense probably benign
R6246:Smc2 UTSW 4 52460289 missense probably damaging 1.00
R6321:Smc2 UTSW 4 52462814 missense probably benign
R6590:Smc2 UTSW 4 52449375 missense probably benign 0.01
R6658:Smc2 UTSW 4 52451322 missense probably benign 0.21
R6690:Smc2 UTSW 4 52449375 missense probably benign 0.01
R7422:Smc2 UTSW 4 52440301 missense probably benign 0.02
R7486:Smc2 UTSW 4 52462861 missense possibly damaging 0.54
R7487:Smc2 UTSW 4 52478448 missense probably damaging 1.00
R7532:Smc2 UTSW 4 52451013 missense probably damaging 1.00
R7556:Smc2 UTSW 4 52457379 missense probably benign 0.03
R7912:Smc2 UTSW 4 52450854 missense probably benign 0.00
R7953:Smc2 UTSW 4 52470911 critical splice donor site probably null
R7979:Smc2 UTSW 4 52450857 missense probably damaging 1.00
R8343:Smc2 UTSW 4 52450965 missense probably benign
R8344:Smc2 UTSW 4 52449376 missense probably benign 0.01
RF006:Smc2 UTSW 4 52442276 missense probably benign 0.03
X0065:Smc2 UTSW 4 52440370 missense probably damaging 1.00
Z1176:Smc2 UTSW 4 52481682 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCTATTTATACAGAATAGCGC -3'
(R):5'- AGTCTGACATGTGACTTTTCCC -3'

Sequencing Primer
(F):5'- GGTTATTGGTGGCAGAAAT -3'
(R):5'- CCTAACTTAGTACATATTGGCTTCAC -3'
Posted On2014-10-30