Mutagenetix > Incidental Mutations

Incidental Mutation 'R2318:Prr14l'

245549

Institutional Source

Beutler Lab

Gene Symbol

Prr14l

Ensembl Gene

ENSMUSG00000054280

Gene Name

proline rich 14-like

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.160) question?

Stock #

R2318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32789820-32854256 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32830078 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 691 (E691G)

Ref Sequence

ENSEMBL: ENSMUSP00000113259 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]

Predicted Effect

probably benign
Transcript: ENSMUST00000120129
AA Change: E691G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: E691G

Domain	Start	End	E-Value	Type
low complexity region	720	731	N/A	INTRINSIC
low complexity region	1433	1446	N/A	INTRINSIC
low complexity region	1471	1480	N/A	INTRINSIC
Pfam:Tantalus	1838	1895	2.9e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144673

SMART Domains

Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

Domain	Start	End	E-Value	Type
Pfam:Tantalus	158	193	1.2e-15	PFAM
Pfam:PS_Dcarbxylase	332	575	2.1e-71	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155392

SMART Domains

Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280

Domain	Start	End	E-Value	Type
low complexity region	276	289	N/A	INTRINSIC
low complexity region	314	323	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,588,701	Y66H	probably damaging	Het
Arhgef10	G	A	8: 14,928,855	A41T	probably damaging	Het
Car15	T	C	16: 17,836,599	M158V	probably benign	Het
Cinp	C	A	12: 110,874,009	W113L	probably damaging	Het
Col4a3	T	A	1: 82,648,569		probably null	Het
Csnk2b	T	C	17: 35,118,061	Y101C	possibly damaging	Het
Ddb1	C	T	19: 10,626,628	R900C	probably damaging	Het
Eif4g2	A	G	7: 111,073,858	F876L	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Gm5868	T	C	5: 72,586,295	T27A	probably benign	Het
Hist1h4d	A	G	13: 23,581,756	Y52C	probably damaging	Het
Mast1	T	C	8: 84,921,125	D540G	probably damaging	Het
Mis18bp1	C	T	12: 65,140,843	V829M	possibly damaging	Het
Mtus2	C	T	5: 148,107,082	R827*	probably null	Het
Nlrp9a	G	A	7: 26,573,852	V860M	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Rad1	A	G	15: 10,490,409	N154S	probably benign	Het
Smc2	T	C	4: 52,446,030	S133P	probably damaging	Het
Sstr1	T	A	12: 58,212,776	S62T	possibly damaging	Het
Thsd7a	T	C	6: 12,405,147	Y766C	probably damaging	Het
Timm44	A	G	8: 4,268,307	V129A	probably benign	Het
Tinag	T	C	9: 77,045,411	Y97C	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ubap2	A	G	4: 41,251,542	V30A	probably damaging	Het

Other mutations in Prr14l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Prr14l	APN	5	32830676	missense	probably benign	0.04
IGL00331:Prr14l	APN	5	32831066	missense	probably benign	0.02
IGL01571:Prr14l	APN	5	32828806	missense	probably benign	0.01
IGL01795:Prr14l	APN	5	32831845	unclassified	probably benign
IGL01929:Prr14l	APN	5	32828243	missense	probably benign	0.09
IGL01959:Prr14l	APN	5	32830205	missense	possibly damaging	0.84
IGL02139:Prr14l	APN	5	32827532	missense	probably damaging	1.00
IGL02321:Prr14l	APN	5	32827807	missense	probably benign	0.10
IGL02508:Prr14l	APN	5	32830942	missense	probably benign	0.01
IGL02551:Prr14l	APN	5	32831484	missense	probably damaging	1.00
IGL02585:Prr14l	APN	5	32829484	missense	possibly damaging	0.59
IGL02614:Prr14l	APN	5	32830543	missense	possibly damaging	0.76
IGL02808:Prr14l	APN	5	32828182	missense	possibly damaging	0.94
IGL02836:Prr14l	APN	5	32831096	missense	probably benign	0.42
IGL02952:Prr14l	APN	5	32835670	missense	unknown
IGL03034:Prr14l	APN	5	32827438	missense	possibly damaging	0.48
Polymer	UTSW	5	32827145	missense	probably benign	0.34
Postwar	UTSW	5	32830684	missense	probably benign	0.17
H8562:Prr14l	UTSW	5	32793728	missense	probably damaging	1.00
R0086:Prr14l	UTSW	5	32831559	unclassified	probably benign
R0149:Prr14l	UTSW	5	32793641	missense	probably damaging	1.00
R0333:Prr14l	UTSW	5	32827993	missense	probably damaging	1.00
R0361:Prr14l	UTSW	5	32793641	missense	probably damaging	1.00
R0416:Prr14l	UTSW	5	32828717	missense	probably benign	0.25
R0480:Prr14l	UTSW	5	32829880	missense	probably benign	0.02
R0511:Prr14l	UTSW	5	32844216	intron	probably benign
R0639:Prr14l	UTSW	5	32828915	missense	probably benign	0.02
R0673:Prr14l	UTSW	5	32828915	missense	probably benign	0.02
R0743:Prr14l	UTSW	5	32831194	missense	possibly damaging	0.55
R0792:Prr14l	UTSW	5	32828423	missense	probably damaging	1.00
R1006:Prr14l	UTSW	5	32829482	missense	probably benign	0.00
R1342:Prr14l	UTSW	5	32830260	missense	probably damaging	1.00
R1433:Prr14l	UTSW	5	32828833	missense	probably damaging	1.00
R1527:Prr14l	UTSW	5	32827949	missense	possibly damaging	0.75
R1704:Prr14l	UTSW	5	32830282	missense	probably benign	0.01
R1967:Prr14l	UTSW	5	32844469	intron	probably benign
R2129:Prr14l	UTSW	5	32831828	unclassified	probably benign
R2150:Prr14l	UTSW	5	32830702	missense	probably benign	0.14
R2915:Prr14l	UTSW	5	32829768	missense	probably benign	0.04
R3551:Prr14l	UTSW	5	32828619	splice site	probably null
R3820:Prr14l	UTSW	5	32828984	missense	probably damaging	0.99
R3852:Prr14l	UTSW	5	32830345	missense	probably damaging	1.00
R4126:Prr14l	UTSW	5	32828003	missense	probably damaging	0.97
R4345:Prr14l	UTSW	5	32828576	missense	probably damaging	1.00
R4388:Prr14l	UTSW	5	32829254	missense	probably damaging	1.00
R4575:Prr14l	UTSW	5	32793644	missense	probably damaging	1.00
R4596:Prr14l	UTSW	5	32829308	missense	probably benign	0.01
R4690:Prr14l	UTSW	5	32844156	intron	probably benign
R4824:Prr14l	UTSW	5	32844399	intron	probably benign
R4868:Prr14l	UTSW	5	32829937	missense	probably benign	0.04
R4869:Prr14l	UTSW	5	32828833	missense	probably damaging	1.00
R5201:Prr14l	UTSW	5	32830247	missense	possibly damaging	0.52
R5328:Prr14l	UTSW	5	32830021	missense	probably benign	0.00
R5410:Prr14l	UTSW	5	32827777	missense	probably damaging	0.98
R5476:Prr14l	UTSW	5	32844138	intron	probably benign
R5623:Prr14l	UTSW	5	32844508	intron	probably benign
R5730:Prr14l	UTSW	5	32793603	missense	probably damaging	1.00
R5988:Prr14l	UTSW	5	32830851	missense	probably damaging	0.98
R6261:Prr14l	UTSW	5	32829404	missense	possibly damaging	0.46
R6283:Prr14l	UTSW	5	32830264	missense	probably benign	0.14
R6307:Prr14l	UTSW	5	32827525	missense	probably damaging	0.97
R6825:Prr14l	UTSW	5	32828548	missense	possibly damaging	0.86
R6862:Prr14l	UTSW	5	32827759	missense	probably damaging	1.00
R6880:Prr14l	UTSW	5	32830867	missense	probably benign	0.01
R6931:Prr14l	UTSW	5	32830691	missense	probably damaging	0.98
R7101:Prr14l	UTSW	5	32829427	missense	probably damaging	1.00
R7164:Prr14l	UTSW	5	32829166	missense	probably damaging	1.00
R7203:Prr14l	UTSW	5	32827145	missense	probably benign	0.34
R7211:Prr14l	UTSW	5	32830087	missense	probably damaging	0.98
R7305:Prr14l	UTSW	5	32831101	missense	probably benign	0.14
R7346:Prr14l	UTSW	5	32830684	missense	probably benign	0.17
R7395:Prr14l	UTSW	5	32828638	missense	probably benign	0.00
R7624:Prr14l	UTSW	5	32829623	missense	possibly damaging	0.54
R7649:Prr14l	UTSW	5	32828245	missense	probably benign	0.18
R7753:Prr14l	UTSW	5	32827253	missense	probably damaging	1.00
R7828:Prr14l	UTSW	5	32844391	intron	probably benign
R7898:Prr14l	UTSW	5	32829966	missense	probably benign	0.04
R8071:Prr14l	UTSW	5	32831164	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- CTTGTGTGTCACAGGCAGAG -3'
(R):5'- AGTCTCAGGATATCTTCAGCTGTC -3'

Sequencing Primer
(F):5'- AATCTCAGTGTCTATGCGTTGATC -3'
(R):5'- GCTGTCACTGCATAACACGAGATG -3'

Posted On

2014-10-30