Incidental Mutation 'R2318:Gm5868'
ID245550
Institutional Source Beutler Lab
Gene Symbol Gm5868
Ensembl Gene ENSMUSG00000060204
Gene Namepredicted gene 5868
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R2318 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location72581638-72587551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72586295 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 27 (T27A)
Ref Sequence ENSEMBL: ENSMUSP00000031124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031124]
Predicted Effect probably benign
Transcript: ENSMUST00000031124
AA Change: T27A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031124
Gene: ENSMUSG00000060204
AA Change: T27A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
transmembrane domain 91 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Gm5868
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01145:Gm5868 APN 5 72586204 critical splice donor site probably null
R4096:Gm5868 UTSW 5 72586366 missense probably damaging 1.00
R7002:Gm5868 UTSW 5 72586420 critical splice acceptor site probably null
Z1177:Gm5868 UTSW 5 72586346 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTAAGTGTGTCCCTGAAAGGCC -3'
(R):5'- CGGGGCTTTGTAACAGGTAAG -3'

Sequencing Primer
(F):5'- GTGTCCCTGAAAGGCCTTTGTATC -3'
(R):5'- AAAGACATGGCTGACTGGCTC -3'
Posted On2014-10-30