Mutagenetix > Incidental Mutation

Incidental Mutation 'R2318:Eif4g2'

245557

Institutional Source

Beutler Lab

Gene Symbol

Eif4g2

Ensembl Gene

ENSMUSG00000005610

Gene Name

eukaryotic translation initiation factor 4, gamma 2

Synonyms

DAP-5, Nat1, E130105L11Rik, Natm1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

111067750-111083030 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 111073858 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 876 (F876L)

Ref Sequence

ENSEMBL: ENSMUSP00000124551 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160132] [ENSMUST00000161051] [ENSMUST00000162415]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158323

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159465

Predicted Effect

probably benign
Transcript: ENSMUST00000160132

SMART Domains

Protein: ENSMUSP00000124914
Gene: ENSMUSG00000005610

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	61	69	N/A	INTRINSIC
Pfam:MIF4G	78	152	1.3e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160552

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161051
AA Change: F838L

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000125375
Gene: ENSMUSG00000005610
AA Change: F838L

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	61	69	N/A	INTRINSIC
MIF4G	78	308	2.08e-58	SMART
MA3	505	618	4.76e-35	SMART
low complexity region	634	646	N/A	INTRINSIC
low complexity region	682	704	N/A	INTRINSIC
low complexity region	760	771	N/A	INTRINSIC
eIF5C	775	861	5.43e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161079

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161158

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161682

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161790

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162415
AA Change: F876L

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000124551
Gene: ENSMUSG00000005610
AA Change: F876L

Domain	Start	End	E-Value	Type
low complexity region	8	25	N/A	INTRINSIC
low complexity region	61	69	N/A	INTRINSIC
MIF4G	78	308	2.08e-58	SMART
low complexity region	441	453	N/A	INTRINSIC
Blast:MIF4G	454	490	4e-14	BLAST
MA3	543	656	4.76e-35	SMART
low complexity region	672	684	N/A	INTRINSIC
low complexity region	720	742	N/A	INTRINSIC
low complexity region	798	809	N/A	INTRINSIC
eIF5C	813	899	5.43e-34	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000163014
AA Change: F102L

SMART Domains

Protein: ENSMUSP00000123811
Gene: ENSMUSG00000005610
AA Change: F102L

Domain	Start	End	E-Value	Type
low complexity region	25	36	N/A	INTRINSIC
Pfam:W2	52	122	2.2e-12	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G, that contains the binding sites for eIF4A and eIF3; eIF4G in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. Transgene expression of the apolipoprotein B mRNA-editing enzyme (APOBEC-1) causes extensive editing of this mRNA, which could contribute to the potent oncogenesis induced by overexpression of APOBEC-1. In vitro and in vivo studies in human indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. This also appears to be true for mouse. Two alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation fail to undergo gastrulation and die by E11.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,588,701	Y66H	probably damaging	Het
Arhgef10	G	A	8: 14,928,855	A41T	probably damaging	Het
Car15	T	C	16: 17,836,599	M158V	probably benign	Het
Cinp	C	A	12: 110,874,009	W113L	probably damaging	Het
Col4a3	T	A	1: 82,648,569		probably null	Het
Csnk2b	T	C	17: 35,118,061	Y101C	possibly damaging	Het
Ddb1	C	T	19: 10,626,628	R900C	probably damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Gm5868	T	C	5: 72,586,295	T27A	probably benign	Het
Hist1h4d	A	G	13: 23,581,756	Y52C	probably damaging	Het
Mast1	T	C	8: 84,921,125	D540G	probably damaging	Het
Mis18bp1	C	T	12: 65,140,843	V829M	possibly damaging	Het
Mtus2	C	T	5: 148,107,082	R827*	probably null	Het
Nlrp9a	G	A	7: 26,573,852	V860M	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prr14l	T	C	5: 32,830,078	E691G	probably benign	Het
Rad1	A	G	15: 10,490,409	N154S	probably benign	Het
Smc2	T	C	4: 52,446,030	S133P	probably damaging	Het
Sstr1	T	A	12: 58,212,776	S62T	possibly damaging	Het
Thsd7a	T	C	6: 12,405,147	Y766C	probably damaging	Het
Timm44	A	G	8: 4,268,307	V129A	probably benign	Het
Tinag	T	C	9: 77,045,411	Y97C	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ubap2	A	G	4: 41,251,542	V30A	probably damaging	Het

Other mutations in Eif4g2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01302:Eif4g2	APN	7	111074713	missense	possibly damaging	0.91
IGL01402:Eif4g2	APN	7	111077027	missense	possibly damaging	0.94
IGL02502:Eif4g2	APN	7	111081541	missense	probably damaging	0.98
IGL02538:Eif4g2	APN	7	111079316	missense	probably benign	0.03
IGL02717:Eif4g2	APN	7	111078113	missense	probably benign	0.45
R0547:Eif4g2	UTSW	7	111078293	missense	probably damaging	1.00
R0614:Eif4g2	UTSW	7	111077223	critical splice donor site	probably null
R1351:Eif4g2	UTSW	7	111074080	missense	probably damaging	1.00
R1764:Eif4g2	UTSW	7	111074487	missense	probably damaging	1.00
R2009:Eif4g2	UTSW	7	111074198	missense	probably benign	0.01
R2382:Eif4g2	UTSW	7	111075046	missense	probably benign	0.00
R2986:Eif4g2	UTSW	7	111078483	missense	probably damaging	0.99
R4012:Eif4g2	UTSW	7	111074151	missense	possibly damaging	0.86
R4592:Eif4g2	UTSW	7	111078302	missense	probably damaging	1.00
R4785:Eif4g2	UTSW	7	111076796	missense	probably damaging	0.99
R5037:Eif4g2	UTSW	7	111077032	missense	probably benign	0.03
R5627:Eif4g2	UTSW	7	111074239	missense	probably benign	0.32
R5988:Eif4g2	UTSW	7	111077230	missense	probably benign	0.11
R6229:Eif4g2	UTSW	7	111077713	splice site	probably null
R8122:Eif4g2	UTSW	7	111078553	missense	possibly damaging	0.93
R8218:Eif4g2	UTSW	7	111074432	missense	possibly damaging	0.62
R8711:Eif4g2	UTSW	7	111073920	missense	probably damaging	1.00
R8726:Eif4g2	UTSW	7	111077422	missense	probably damaging	1.00
R9156:Eif4g2	UTSW	7	111073762	missense
R9216:Eif4g2	UTSW	7	111074208	missense	probably benign	0.08
R9277:Eif4g2	UTSW	7	111074859	missense	probably damaging	0.98
R9334:Eif4g2	UTSW	7	111074824	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- CTTTAACCATGCAAACAGCTCTATC -3'
(R):5'- GCTTCCCAAAAGGTGAGGTG -3'

Sequencing Primer
(F):5'- GCTCTATCACCAAAATTGTCACC -3'
(R):5'- TCCCAAAAGGTGAGGTGACTGTTC -3'

Posted On

2014-10-30