Incidental Mutation 'R2318:Eif4g2'
ID 245557
Institutional Source Beutler Lab
Gene Symbol Eif4g2
Ensembl Gene ENSMUSG00000005610
Gene Name eukaryotic translation initiation factor 4, gamma 2
Synonyms DAP-5, Nat1, E130105L11Rik, Natm1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2318 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 111067750-111083030 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111073858 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 876 (F876L)
Ref Sequence ENSEMBL: ENSMUSP00000124551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160132] [ENSMUST00000161051] [ENSMUST00000162415]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159465
Predicted Effect probably benign
Transcript: ENSMUST00000160132
SMART Domains Protein: ENSMUSP00000124914
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
Pfam:MIF4G 78 152 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160552
Predicted Effect possibly damaging
Transcript: ENSMUST00000161051
AA Change: F838L

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125375
Gene: ENSMUSG00000005610
AA Change: F838L

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
MA3 505 618 4.76e-35 SMART
low complexity region 634 646 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 760 771 N/A INTRINSIC
eIF5C 775 861 5.43e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161079
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161790
Predicted Effect possibly damaging
Transcript: ENSMUST00000162415
AA Change: F876L

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124551
Gene: ENSMUSG00000005610
AA Change: F876L

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
low complexity region 441 453 N/A INTRINSIC
Blast:MIF4G 454 490 4e-14 BLAST
MA3 543 656 4.76e-35 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 798 809 N/A INTRINSIC
eIF5C 813 899 5.43e-34 SMART
Predicted Effect unknown
Transcript: ENSMUST00000163014
AA Change: F102L
SMART Domains Protein: ENSMUSP00000123811
Gene: ENSMUSG00000005610
AA Change: F102L

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:W2 52 122 2.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G, that contains the binding sites for eIF4A and eIF3; eIF4G in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. Transgene expression of the apolipoprotein B mRNA-editing enzyme (APOBEC-1) causes extensive editing of this mRNA, which could contribute to the potent oncogenesis induced by overexpression of APOBEC-1. In vitro and in vivo studies in human indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. This also appears to be true for mouse. Two alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation fail to undergo gastrulation and die by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Eif4g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Eif4g2 APN 7 111074713 missense possibly damaging 0.91
IGL01402:Eif4g2 APN 7 111077027 missense possibly damaging 0.94
IGL02502:Eif4g2 APN 7 111081541 missense probably damaging 0.98
IGL02538:Eif4g2 APN 7 111079316 missense probably benign 0.03
IGL02717:Eif4g2 APN 7 111078113 missense probably benign 0.45
R0547:Eif4g2 UTSW 7 111078293 missense probably damaging 1.00
R0614:Eif4g2 UTSW 7 111077223 critical splice donor site probably null
R1351:Eif4g2 UTSW 7 111074080 missense probably damaging 1.00
R1764:Eif4g2 UTSW 7 111074487 missense probably damaging 1.00
R2009:Eif4g2 UTSW 7 111074198 missense probably benign 0.01
R2382:Eif4g2 UTSW 7 111075046 missense probably benign 0.00
R2986:Eif4g2 UTSW 7 111078483 missense probably damaging 0.99
R4012:Eif4g2 UTSW 7 111074151 missense possibly damaging 0.86
R4592:Eif4g2 UTSW 7 111078302 missense probably damaging 1.00
R4785:Eif4g2 UTSW 7 111076796 missense probably damaging 0.99
R5037:Eif4g2 UTSW 7 111077032 missense probably benign 0.03
R5627:Eif4g2 UTSW 7 111074239 missense probably benign 0.32
R5988:Eif4g2 UTSW 7 111077230 missense probably benign 0.11
R6229:Eif4g2 UTSW 7 111077713 splice site probably null
R8122:Eif4g2 UTSW 7 111078553 missense possibly damaging 0.93
R8218:Eif4g2 UTSW 7 111074432 missense possibly damaging 0.62
R8711:Eif4g2 UTSW 7 111073920 missense probably damaging 1.00
R8726:Eif4g2 UTSW 7 111077422 missense probably damaging 1.00
R9156:Eif4g2 UTSW 7 111073762 missense
R9216:Eif4g2 UTSW 7 111074208 missense probably benign 0.08
R9277:Eif4g2 UTSW 7 111074859 missense probably damaging 0.98
R9334:Eif4g2 UTSW 7 111074824 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTTTAACCATGCAAACAGCTCTATC -3'
(R):5'- GCTTCCCAAAAGGTGAGGTG -3'

Sequencing Primer
(F):5'- GCTCTATCACCAAAATTGTCACC -3'
(R):5'- TCCCAAAAGGTGAGGTGACTGTTC -3'
Posted On 2014-10-30