Mutagenetix > Incidental Mutations

Incidental Mutation 'R2318:Timm44'

245558

Institutional Source

Beutler Lab

Gene Symbol

Timm44

Ensembl Gene

ENSMUSG00000002949

Gene Name

translocase of inner mitochondrial membrane 44

Synonyms

Mimt44, 0710005E20Rik, Tim44, D8Ertd118e

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R2318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4259731-4275913 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 4268307 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 129 (V129A)

Ref Sequence

ENSEMBL: ENSMUSP00000003029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003029]

Predicted Effect

probably benign
Transcript: ENSMUST00000003029
AA Change: V129A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949
AA Change: V129A

Domain	Start	End	E-Value	Type
coiled coil region	60	117	N/A	INTRINSIC
Tim44	296	445	9.67e-36	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147831

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160371

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160549

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161143

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,588,701	Y66H	probably damaging	Het
Arhgef10	G	A	8: 14,928,855	A41T	probably damaging	Het
Car15	T	C	16: 17,836,599	M158V	probably benign	Het
Cinp	C	A	12: 110,874,009	W113L	probably damaging	Het
Col4a3	T	A	1: 82,648,569		probably null	Het
Csnk2b	T	C	17: 35,118,061	Y101C	possibly damaging	Het
Ddb1	C	T	19: 10,626,628	R900C	probably damaging	Het
Eif4g2	A	G	7: 111,073,858	F876L	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Gm5868	T	C	5: 72,586,295	T27A	probably benign	Het
Hist1h4d	A	G	13: 23,581,756	Y52C	probably damaging	Het
Mast1	T	C	8: 84,921,125	D540G	probably damaging	Het
Mis18bp1	C	T	12: 65,140,843	V829M	possibly damaging	Het
Mtus2	C	T	5: 148,107,082	R827*	probably null	Het
Nlrp9a	G	A	7: 26,573,852	V860M	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prr14l	T	C	5: 32,830,078	E691G	probably benign	Het
Rad1	A	G	15: 10,490,409	N154S	probably benign	Het
Smc2	T	C	4: 52,446,030	S133P	probably damaging	Het
Sstr1	T	A	12: 58,212,776	S62T	possibly damaging	Het
Thsd7a	T	C	6: 12,405,147	Y766C	probably damaging	Het
Tinag	T	C	9: 77,045,411	Y97C	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ubap2	A	G	4: 41,251,542	V30A	probably damaging	Het

Other mutations in Timm44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01544:Timm44	APN	8	4275888	utr 5 prime	probably benign
IGL01768:Timm44	APN	8	4266860	missense	probably benign	0.00
IGL02336:Timm44	APN	8	4267692	missense	probably damaging	1.00
R0505:Timm44	UTSW	8	4260532	nonsense	probably null
R0883:Timm44	UTSW	8	4266592	missense	probably benign
R1842:Timm44	UTSW	8	4260510	critical splice donor site	probably null
R1965:Timm44	UTSW	8	4260603	missense	possibly damaging	0.65
R2243:Timm44	UTSW	8	4267871	missense	possibly damaging	0.91
R2518:Timm44	UTSW	8	4266588	missense	probably null	1.00
R4049:Timm44	UTSW	8	4260561	missense	probably benign	0.00
R4489:Timm44	UTSW	8	4266654	missense	possibly damaging	0.48
R4803:Timm44	UTSW	8	4267932	missense	probably damaging	0.99
R5001:Timm44	UTSW	8	4275886	start codon destroyed	probably null	0.98
R5260:Timm44	UTSW	8	4275919	splice site	probably null
R5335:Timm44	UTSW	8	4266814	missense	probably damaging	1.00
R5502:Timm44	UTSW	8	4269992	missense	possibly damaging	0.93
R5602:Timm44	UTSW	8	4266769	critical splice donor site	probably null
R5700:Timm44	UTSW	8	4274171	missense	probably damaging	1.00
R6004:Timm44	UTSW	8	4267747	missense	probably benign	0.00
R6186:Timm44	UTSW	8	4266824	missense	probably damaging	1.00
R6524:Timm44	UTSW	8	4267988	missense	possibly damaging	0.68
R6823:Timm44	UTSW	8	4267282	missense	probably damaging	1.00
R6996:Timm44	UTSW	8	4266611	missense	possibly damaging	0.87
R7183:Timm44	UTSW	8	4267311	missense	probably damaging	0.98
R7844:Timm44	UTSW	8	4269976	missense	possibly damaging	0.71
R8209:Timm44	UTSW	8	4266844	missense	probably benign	0.02
R8532:Timm44	UTSW	8	4260549	missense	possibly damaging	0.63
Z1088:Timm44	UTSW	8	4268004	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAACCTTTTAAGTTCAGGGTGC -3'
(R):5'- AAGCTCTTCACAGAGTTTAAGCAGC -3'

Sequencing Primer
(F):5'- CTCCCTGGAATGGACATGAGTG -3'
(R):5'- CTTCACAGAGTTTAAGCAGCCAGTG -3'

Posted On

2014-10-30