Incidental Mutation 'R2318:Timm44'
ID 245558
Institutional Source Beutler Lab
Gene Symbol Timm44
Ensembl Gene ENSMUSG00000002949
Gene Name translocase of inner mitochondrial membrane 44
Synonyms D8Ertd118e, Mimt44, 0710005E20Rik, Tim44
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R2318 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 4309731-4325905 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 4318307 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 129 (V129A)
Ref Sequence ENSEMBL: ENSMUSP00000003029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003029]
AlphaFold O35857
Predicted Effect probably benign
Transcript: ENSMUST00000003029
AA Change: V129A

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000003029
Gene: ENSMUSG00000002949
AA Change: V129A

DomainStartEndE-ValueType
coiled coil region 60 117 N/A INTRINSIC
Tim44 296 445 9.67e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141195
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160371
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160549
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161143
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a peripheral membrane protein associated with the mitochondrial inner membrane translocase, which functions in the import of proteins across the mitochondrial inner membrane and into the mitochondrial matrix. The encoded protein mediates binding of mitochondrial heat shock protein 70 to the translocase of inner mitochondrial membrane 23 (TIM23) complex. Expression of this gene is upregulated in kidney in a mouse model of diabetes. A mutation in this gene is associated with familial oncocytic thyroid carcinoma. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10 G A 8: 14,978,855 (GRCm39) A41T probably damaging Het
Car15 T C 16: 17,654,463 (GRCm39) M158V probably benign Het
Cinp C A 12: 110,840,443 (GRCm39) W113L probably damaging Het
Col4a3 T A 1: 82,626,290 (GRCm39) probably null Het
Csnk2b T C 17: 35,337,037 (GRCm39) Y101C possibly damaging Het
Ddb1 C T 19: 10,603,992 (GRCm39) R900C probably damaging Het
Eif4g2 A G 7: 110,673,065 (GRCm39) F876L possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
H4c4 A G 13: 23,765,739 (GRCm39) Y52C probably damaging Het
Mast1 T C 8: 85,647,754 (GRCm39) D540G probably damaging Het
Mis18bp1 C T 12: 65,187,617 (GRCm39) V829M possibly damaging Het
Mtus2 C T 5: 148,043,892 (GRCm39) R827* probably null Het
Nlrp9a G A 7: 26,273,277 (GRCm39) V860M probably damaging Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prr14l T C 5: 32,987,422 (GRCm39) E691G probably benign Het
Rad1 A G 15: 10,490,495 (GRCm39) N154S probably benign Het
Sanbr A G 11: 23,538,701 (GRCm39) Y66H probably damaging Het
Slc10a4-ps T C 5: 72,743,638 (GRCm39) T27A probably benign Het
Smc2 T C 4: 52,446,030 (GRCm39) S133P probably damaging Het
Sstr1 T A 12: 58,259,562 (GRCm39) S62T possibly damaging Het
Thsd7a T C 6: 12,405,146 (GRCm39) Y766C probably damaging Het
Tinag T C 9: 76,952,693 (GRCm39) Y97C probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ubap2 A G 4: 41,251,542 (GRCm39) V30A probably damaging Het
Other mutations in Timm44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Timm44 APN 8 4,325,888 (GRCm39) utr 5 prime probably benign
IGL01768:Timm44 APN 8 4,316,860 (GRCm39) missense probably benign 0.00
IGL02336:Timm44 APN 8 4,317,692 (GRCm39) missense probably damaging 1.00
lassie UTSW 8 4,310,621 (GRCm39) missense probably damaging 1.00
Togo UTSW 8 4,320,019 (GRCm39) missense probably benign 0.10
R0505:Timm44 UTSW 8 4,310,532 (GRCm39) nonsense probably null
R0883:Timm44 UTSW 8 4,316,592 (GRCm39) missense probably benign
R1842:Timm44 UTSW 8 4,310,510 (GRCm39) critical splice donor site probably null
R1965:Timm44 UTSW 8 4,310,603 (GRCm39) missense possibly damaging 0.65
R2243:Timm44 UTSW 8 4,317,871 (GRCm39) missense possibly damaging 0.91
R2518:Timm44 UTSW 8 4,316,588 (GRCm39) missense probably null 1.00
R4049:Timm44 UTSW 8 4,310,561 (GRCm39) missense probably benign 0.00
R4489:Timm44 UTSW 8 4,316,654 (GRCm39) missense possibly damaging 0.48
R4803:Timm44 UTSW 8 4,317,932 (GRCm39) missense probably damaging 0.99
R5001:Timm44 UTSW 8 4,325,886 (GRCm39) start codon destroyed probably null 0.98
R5260:Timm44 UTSW 8 4,325,919 (GRCm39) splice site probably null
R5335:Timm44 UTSW 8 4,316,814 (GRCm39) missense probably damaging 1.00
R5502:Timm44 UTSW 8 4,319,992 (GRCm39) missense possibly damaging 0.93
R5602:Timm44 UTSW 8 4,316,769 (GRCm39) critical splice donor site probably null
R5700:Timm44 UTSW 8 4,324,171 (GRCm39) missense probably damaging 1.00
R6004:Timm44 UTSW 8 4,317,747 (GRCm39) missense probably benign 0.00
R6186:Timm44 UTSW 8 4,316,824 (GRCm39) missense probably damaging 1.00
R6524:Timm44 UTSW 8 4,317,988 (GRCm39) missense possibly damaging 0.68
R6823:Timm44 UTSW 8 4,317,282 (GRCm39) missense probably damaging 1.00
R6996:Timm44 UTSW 8 4,316,611 (GRCm39) missense possibly damaging 0.87
R7183:Timm44 UTSW 8 4,317,311 (GRCm39) missense probably damaging 0.98
R7844:Timm44 UTSW 8 4,319,976 (GRCm39) missense possibly damaging 0.71
R8209:Timm44 UTSW 8 4,316,844 (GRCm39) missense probably benign 0.02
R8532:Timm44 UTSW 8 4,310,549 (GRCm39) missense possibly damaging 0.63
R8785:Timm44 UTSW 8 4,320,019 (GRCm39) missense probably benign 0.10
R9003:Timm44 UTSW 8 4,324,204 (GRCm39) missense possibly damaging 0.89
R9262:Timm44 UTSW 8 4,310,621 (GRCm39) missense probably damaging 1.00
R9537:Timm44 UTSW 8 4,310,576 (GRCm39) missense possibly damaging 0.90
R9759:Timm44 UTSW 8 4,317,707 (GRCm39) nonsense probably null
Z1088:Timm44 UTSW 8 4,318,004 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAACCTTTTAAGTTCAGGGTGC -3'
(R):5'- AAGCTCTTCACAGAGTTTAAGCAGC -3'

Sequencing Primer
(F):5'- CTCCCTGGAATGGACATGAGTG -3'
(R):5'- CTTCACAGAGTTTAAGCAGCCAGTG -3'
Posted On 2014-10-30