Mutagenetix > Incidental Mutations

Incidental Mutation 'R2318:Arhgef10'

245559

Institutional Source

Beutler Lab

Gene Symbol

Arhgef10

Ensembl Gene

ENSMUSG00000071176

Gene Name

Rho guanine nucleotide exchange factor (GEF) 10

Synonyms

6430549H08Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14911663-15001085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14928855 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 41 (A41T)

Ref Sequence

ENSEMBL: ENSMUSP00000125606 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000161162]

AlphaFold

Q8C033

Predicted Effect

probably damaging
Transcript: ENSMUST00000084207
AA Change: A41T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: A41T

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
coiled coil region	308	335	N/A	INTRINSIC
RhoGEF	401	583	9.79e-58	SMART
Blast:PH	617	829	6e-47	BLAST
low complexity region	1256	1272	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110800
AA Change: A41T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: A41T

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
RhoGEF	362	544	9.79e-58	SMART
Blast:PH	578	790	8e-47	BLAST
low complexity region	1217	1233	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160619

Predicted Effect

probably damaging
Transcript: ENSMUST00000161162
AA Change: A41T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125606
Gene: ENSMUSG00000071176
AA Change: A41T

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
low complexity region	246	264	N/A	INTRINSIC
coiled coil region	307	334	N/A	INTRINSIC
RhoGEF	400	579	2.2e-51	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,588,701	Y66H	probably damaging	Het
Car15	T	C	16: 17,836,599	M158V	probably benign	Het
Cinp	C	A	12: 110,874,009	W113L	probably damaging	Het
Col4a3	T	A	1: 82,648,569		probably null	Het
Csnk2b	T	C	17: 35,118,061	Y101C	possibly damaging	Het
Ddb1	C	T	19: 10,626,628	R900C	probably damaging	Het
Eif4g2	A	G	7: 111,073,858	F876L	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Gm5868	T	C	5: 72,586,295	T27A	probably benign	Het
Hist1h4d	A	G	13: 23,581,756	Y52C	probably damaging	Het
Mast1	T	C	8: 84,921,125	D540G	probably damaging	Het
Mis18bp1	C	T	12: 65,140,843	V829M	possibly damaging	Het
Mtus2	C	T	5: 148,107,082	R827*	probably null	Het
Nlrp9a	G	A	7: 26,573,852	V860M	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prr14l	T	C	5: 32,830,078	E691G	probably benign	Het
Rad1	A	G	15: 10,490,409	N154S	probably benign	Het
Smc2	T	C	4: 52,446,030	S133P	probably damaging	Het
Sstr1	T	A	12: 58,212,776	S62T	possibly damaging	Het
Thsd7a	T	C	6: 12,405,147	Y766C	probably damaging	Het
Timm44	A	G	8: 4,268,307	V129A	probably benign	Het
Tinag	T	C	9: 77,045,411	Y97C	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ubap2	A	G	4: 41,251,542	V30A	probably damaging	Het

Other mutations in Arhgef10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arhgef10	APN	8	14975006	missense	probably damaging	1.00
IGL00823:Arhgef10	APN	8	14940378	unclassified	probably benign
IGL01012:Arhgef10	APN	8	14979977	missense	probably damaging	0.99
IGL01311:Arhgef10	APN	8	14991054	splice site	probably null
IGL01596:Arhgef10	APN	8	14999468	nonsense	probably null
IGL01888:Arhgef10	APN	8	14962577	nonsense	probably null
IGL01938:Arhgef10	APN	8	14991062	missense	probably benign	0.09
IGL02151:Arhgef10	APN	8	14928889	missense	possibly damaging	0.77
IGL02274:Arhgef10	APN	8	14947205	missense	probably damaging	0.99
IGL02369:Arhgef10	APN	8	14997551	missense	probably damaging	1.00
IGL02411:Arhgef10	APN	8	14954819	missense	probably benign	0.01
IGL02500:Arhgef10	APN	8	14961238	missense	probably damaging	1.00
IGL02597:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02602:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02743:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02744:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL03113:Arhgef10	APN	8	14954505	missense	probably damaging	1.00
IGL03248:Arhgef10	APN	8	14928847	missense	probably benign	0.00
P0028:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
P4748:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
R0049:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R0197:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0479:Arhgef10	UTSW	8	14991070	missense	probably damaging	0.98
R0701:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0966:Arhgef10	UTSW	8	14940343	missense	probably benign	0.01
R1367:Arhgef10	UTSW	8	14940225	missense	probably damaging	1.00
R1572:Arhgef10	UTSW	8	14991211	missense	possibly damaging	0.53
R1631:Arhgef10	UTSW	8	14947157	missense	probably damaging	0.98
R1766:Arhgef10	UTSW	8	14979836	missense	probably damaging	1.00
R1920:Arhgef10	UTSW	8	14956987	splice site	probably benign
R2051:Arhgef10	UTSW	8	14945320	missense	probably null	1.00
R2088:Arhgef10	UTSW	8	14983898	missense	possibly damaging	0.46
R2118:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2120:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2121:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2122:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2124:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2874:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2874:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R3522:Arhgef10	UTSW	8	14954918	missense	probably damaging	1.00
R4049:Arhgef10	UTSW	8	14979998	missense	probably benign	0.05
R4324:Arhgef10	UTSW	8	14940335	missense	possibly damaging	0.77
R4351:Arhgef10	UTSW	8	14991145	nonsense	probably null
R4384:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4385:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4685:Arhgef10	UTSW	8	14956963	missense	probably damaging	1.00
R5111:Arhgef10	UTSW	8	14932408	missense	probably benign	0.00
R5169:Arhgef10	UTSW	8	14930051	missense	possibly damaging	0.80
R5670:Arhgef10	UTSW	8	14954774	missense	probably benign	0.01
R5945:Arhgef10	UTSW	8	14980028	critical splice donor site	probably null
R6593:Arhgef10	UTSW	8	14962522	missense	probably damaging	1.00
R6593:Arhgef10	UTSW	8	14962564	missense	possibly damaging	0.82
R6734:Arhgef10	UTSW	8	14975053	missense	probably damaging	1.00
R6859:Arhgef10	UTSW	8	14975005	missense	probably damaging	1.00
R6890:Arhgef10	UTSW	8	14928786	missense	probably benign	0.27
R7068:Arhgef10	UTSW	8	14958639	missense	probably damaging	1.00
R7081:Arhgef10	UTSW	8	14997547	nonsense	probably null
R7157:Arhgef10	UTSW	8	14930030	missense	probably damaging	1.00
R7232:Arhgef10	UTSW	8	14940323	missense	probably benign	0.10
R7514:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R7544:Arhgef10	UTSW	8	14979854	missense	probably benign	0.34
R7657:Arhgef10	UTSW	8	14979893	missense	probably damaging	1.00
R7736:Arhgef10	UTSW	8	14980583	nonsense	probably null
R7777:Arhgef10	UTSW	8	14945373	missense	probably damaging	1.00
R8000:Arhgef10	UTSW	8	14930054	missense	probably damaging	1.00
R8060:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R8441:Arhgef10	UTSW	8	14991237	splice site	probably benign
R8545:Arhgef10	UTSW	8	14928868	missense	probably benign	0.00
R8545:Arhgef10	UTSW	8	14975931	missense	possibly damaging	0.83
R8702:Arhgef10	UTSW	8	14942638	missense	probably benign
R8846:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R8854:Arhgef10	UTSW	8	14979798	critical splice acceptor site	probably null
R9076:Arhgef10	UTSW	8	14974993	missense	probably damaging	1.00
R9384:Arhgef10	UTSW	8	14991067	missense	probably damaging	0.99
X0024:Arhgef10	UTSW	8	14978486	missense	probably benign	0.01
X0027:Arhgef10	UTSW	8	14997631	missense	possibly damaging	0.92
Z1088:Arhgef10	UTSW	8	14964191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGTTAGTTAGCCCTGCACAG -3'
(R):5'- CTTTGGTCTGTGCTACAAGC -3'

Sequencing Primer
(F):5'- CAGGGAGGTTGCAAATGGCTTC -3'
(R):5'- TCTGTGCTACAAGCCCGGAC -3'

Posted On

2014-10-30