Incidental Mutation 'R2318:Arhgef10'
ID 245559
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene Name Rho guanine nucleotide exchange factor (GEF) 10
Synonyms 6430549H08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2318 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 14911663-15001085 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 14928855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 41 (A41T)
Ref Sequence ENSEMBL: ENSMUSP00000125606 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000161162]
AlphaFold Q8C033
Predicted Effect probably damaging
Transcript: ENSMUST00000084207
AA Change: A41T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: A41T

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110800
AA Change: A41T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: A41T

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160619
Predicted Effect probably damaging
Transcript: ENSMUST00000161162
AA Change: A41T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125606
Gene: ENSMUSG00000071176
AA Change: A41T

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
coiled coil region 307 334 N/A INTRINSIC
RhoGEF 400 579 2.2e-51 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 14975006 missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14940378 unclassified probably benign
IGL01012:Arhgef10 APN 8 14979977 missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 14991054 splice site probably null
IGL01596:Arhgef10 APN 8 14999468 nonsense probably null
IGL01888:Arhgef10 APN 8 14962577 nonsense probably null
IGL01938:Arhgef10 APN 8 14991062 missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14928889 missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14947205 missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 14997551 missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 14954819 missense probably benign 0.01
IGL02500:Arhgef10 APN 8 14961238 missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL03113:Arhgef10 APN 8 14954505 missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14928847 missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R0197:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 14991070 missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14940343 missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14940225 missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 14991211 missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14947157 missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 14979836 missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 14956987 splice site probably benign
R2051:Arhgef10 UTSW 8 14945320 missense probably null 1.00
R2088:Arhgef10 UTSW 8 14983898 missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2874:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2874:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R3522:Arhgef10 UTSW 8 14954918 missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 14979998 missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14940335 missense possibly damaging 0.77
R4351:Arhgef10 UTSW 8 14991145 nonsense probably null
R4384:Arhgef10 UTSW 8 14930157 nonsense probably null
R4385:Arhgef10 UTSW 8 14930157 nonsense probably null
R4685:Arhgef10 UTSW 8 14956963 missense probably damaging 1.00
R5111:Arhgef10 UTSW 8 14932408 missense probably benign 0.00
R5169:Arhgef10 UTSW 8 14930051 missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 14954774 missense probably benign 0.01
R5945:Arhgef10 UTSW 8 14980028 critical splice donor site probably null
R6593:Arhgef10 UTSW 8 14962522 missense probably damaging 1.00
R6593:Arhgef10 UTSW 8 14962564 missense possibly damaging 0.82
R6734:Arhgef10 UTSW 8 14975053 missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 14975005 missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14928786 missense probably benign 0.27
R7068:Arhgef10 UTSW 8 14958639 missense probably damaging 1.00
R7081:Arhgef10 UTSW 8 14997547 nonsense probably null
R7157:Arhgef10 UTSW 8 14930030 missense probably damaging 1.00
R7232:Arhgef10 UTSW 8 14940323 missense probably benign 0.10
R7514:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R7544:Arhgef10 UTSW 8 14979854 missense probably benign 0.34
R7657:Arhgef10 UTSW 8 14979893 missense probably damaging 1.00
R7736:Arhgef10 UTSW 8 14980583 nonsense probably null
R7777:Arhgef10 UTSW 8 14945373 missense probably damaging 1.00
R8000:Arhgef10 UTSW 8 14930054 missense probably damaging 1.00
R8060:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R8441:Arhgef10 UTSW 8 14991237 splice site probably benign
R8545:Arhgef10 UTSW 8 14928868 missense probably benign 0.00
R8545:Arhgef10 UTSW 8 14975931 missense possibly damaging 0.83
R8702:Arhgef10 UTSW 8 14942638 missense probably benign
R8846:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R8854:Arhgef10 UTSW 8 14979798 critical splice acceptor site probably null
R9076:Arhgef10 UTSW 8 14974993 missense probably damaging 1.00
R9384:Arhgef10 UTSW 8 14991067 missense probably damaging 0.99
X0024:Arhgef10 UTSW 8 14978486 missense probably benign 0.01
X0027:Arhgef10 UTSW 8 14997631 missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 14964191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTTAGTTAGCCCTGCACAG -3'
(R):5'- CTTTGGTCTGTGCTACAAGC -3'

Sequencing Primer
(F):5'- CAGGGAGGTTGCAAATGGCTTC -3'
(R):5'- TCTGTGCTACAAGCCCGGAC -3'
Posted On 2014-10-30