Mutagenetix > Incidental Mutation

Incidental Mutation 'R2318:Arhgef10'

245559

Institutional Source

Beutler Lab

Gene Symbol

Arhgef10

Ensembl Gene

ENSMUSG00000071176

Gene Name

Rho guanine nucleotide exchange factor 10

Synonyms

6430549H08Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14961663-15051085 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14978855 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 41 (A41T)

Ref Sequence

ENSEMBL: ENSMUSP00000125606 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000161162]

AlphaFold

Q8C033

Predicted Effect

probably damaging
Transcript: ENSMUST00000084207
AA Change: A41T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: A41T

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
coiled coil region	308	335	N/A	INTRINSIC
RhoGEF	401	583	9.79e-58	SMART
Blast:PH	617	829	6e-47	BLAST
low complexity region	1256	1272	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110800
AA Change: A41T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: A41T

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
RhoGEF	362	544	9.79e-58	SMART
Blast:PH	578	790	8e-47	BLAST
low complexity region	1217	1233	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160619

Predicted Effect

probably damaging
Transcript: ENSMUST00000161162
AA Change: A41T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125606
Gene: ENSMUSG00000071176
AA Change: A41T

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	235	244	N/A	INTRINSIC
low complexity region	246	264	N/A	INTRINSIC
coiled coil region	307	334	N/A	INTRINSIC
RhoGEF	400	579	2.2e-51	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Car15	T	C	16: 17,654,463 (GRCm39)	M158V	probably benign	Het
Cinp	C	A	12: 110,840,443 (GRCm39)	W113L	probably damaging	Het
Col4a3	T	A	1: 82,626,290 (GRCm39)		probably null	Het
Csnk2b	T	C	17: 35,337,037 (GRCm39)	Y101C	possibly damaging	Het
Ddb1	C	T	19: 10,603,992 (GRCm39)	R900C	probably damaging	Het
Eif4g2	A	G	7: 110,673,065 (GRCm39)	F876L	possibly damaging	Het
F11	A	G	8: 45,701,675 (GRCm39)	S353P	probably damaging	Het
H4c4	A	G	13: 23,765,739 (GRCm39)	Y52C	probably damaging	Het
Mast1	T	C	8: 85,647,754 (GRCm39)	D540G	probably damaging	Het
Mis18bp1	C	T	12: 65,187,617 (GRCm39)	V829M	possibly damaging	Het
Mtus2	C	T	5: 148,043,892 (GRCm39)	R827*	probably null	Het
Nlrp9a	G	A	7: 26,273,277 (GRCm39)	V860M	probably damaging	Het
Plod3	G	C	5: 137,017,000 (GRCm39)	A50P	probably benign	Het
Prr14l	T	C	5: 32,987,422 (GRCm39)	E691G	probably benign	Het
Rad1	A	G	15: 10,490,495 (GRCm39)	N154S	probably benign	Het
Sanbr	A	G	11: 23,538,701 (GRCm39)	Y66H	probably damaging	Het
Slc10a4-ps	T	C	5: 72,743,638 (GRCm39)	T27A	probably benign	Het
Smc2	T	C	4: 52,446,030 (GRCm39)	S133P	probably damaging	Het
Sstr1	T	A	12: 58,259,562 (GRCm39)	S62T	possibly damaging	Het
Thsd7a	T	C	6: 12,405,146 (GRCm39)	Y766C	probably damaging	Het
Timm44	A	G	8: 4,318,307 (GRCm39)	V129A	probably benign	Het
Tinag	T	C	9: 76,952,693 (GRCm39)	Y97C	probably damaging	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het
Ubap2	A	G	4: 41,251,542 (GRCm39)	V30A	probably damaging	Het

Other mutations in Arhgef10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arhgef10	APN	8	15,025,006 (GRCm39)	missense	probably damaging	1.00
IGL00823:Arhgef10	APN	8	14,990,378 (GRCm39)	unclassified	probably benign
IGL01012:Arhgef10	APN	8	15,029,977 (GRCm39)	missense	probably damaging	0.99
IGL01311:Arhgef10	APN	8	15,041,054 (GRCm39)	splice site	probably null
IGL01596:Arhgef10	APN	8	15,049,468 (GRCm39)	nonsense	probably null
IGL01888:Arhgef10	APN	8	15,012,577 (GRCm39)	nonsense	probably null
IGL01938:Arhgef10	APN	8	15,041,062 (GRCm39)	missense	probably benign	0.09
IGL02151:Arhgef10	APN	8	14,978,889 (GRCm39)	missense	possibly damaging	0.77
IGL02274:Arhgef10	APN	8	14,997,205 (GRCm39)	missense	probably damaging	0.99
IGL02369:Arhgef10	APN	8	15,047,551 (GRCm39)	missense	probably damaging	1.00
IGL02411:Arhgef10	APN	8	15,004,819 (GRCm39)	missense	probably benign	0.01
IGL02500:Arhgef10	APN	8	15,011,238 (GRCm39)	missense	probably damaging	1.00
IGL02597:Arhgef10	APN	8	14,980,198 (GRCm39)	missense	probably benign	0.27
IGL02602:Arhgef10	APN	8	14,980,198 (GRCm39)	missense	probably benign	0.27
IGL02743:Arhgef10	APN	8	14,980,198 (GRCm39)	missense	probably benign	0.27
IGL02744:Arhgef10	APN	8	14,980,198 (GRCm39)	missense	probably benign	0.27
IGL03113:Arhgef10	APN	8	15,004,505 (GRCm39)	missense	probably damaging	1.00
IGL03248:Arhgef10	APN	8	14,978,847 (GRCm39)	missense	probably benign	0.00
P0028:Arhgef10	UTSW	8	14,978,925 (GRCm39)	missense	possibly damaging	0.79
P4748:Arhgef10	UTSW	8	14,978,925 (GRCm39)	missense	possibly damaging	0.79
R0049:Arhgef10	UTSW	8	15,004,446 (GRCm39)	missense	probably damaging	1.00
R0197:Arhgef10	UTSW	8	15,012,636 (GRCm39)	missense	probably damaging	1.00
R0479:Arhgef10	UTSW	8	15,041,070 (GRCm39)	missense	probably damaging	0.98
R0701:Arhgef10	UTSW	8	15,012,636 (GRCm39)	missense	probably damaging	1.00
R0966:Arhgef10	UTSW	8	14,990,343 (GRCm39)	missense	probably benign	0.01
R1367:Arhgef10	UTSW	8	14,990,225 (GRCm39)	missense	probably damaging	1.00
R1572:Arhgef10	UTSW	8	15,041,211 (GRCm39)	missense	possibly damaging	0.53
R1631:Arhgef10	UTSW	8	14,997,157 (GRCm39)	missense	probably damaging	0.98
R1766:Arhgef10	UTSW	8	15,029,836 (GRCm39)	missense	probably damaging	1.00
R1920:Arhgef10	UTSW	8	15,006,987 (GRCm39)	splice site	probably benign
R2051:Arhgef10	UTSW	8	14,995,320 (GRCm39)	missense	probably null	1.00
R2088:Arhgef10	UTSW	8	15,033,898 (GRCm39)	missense	possibly damaging	0.46
R2118:Arhgef10	UTSW	8	14,984,820 (GRCm39)	missense	probably damaging	0.99
R2120:Arhgef10	UTSW	8	14,984,820 (GRCm39)	missense	probably damaging	0.99
R2121:Arhgef10	UTSW	8	14,984,820 (GRCm39)	missense	probably damaging	0.99
R2122:Arhgef10	UTSW	8	14,984,820 (GRCm39)	missense	probably damaging	0.99
R2124:Arhgef10	UTSW	8	14,984,820 (GRCm39)	missense	probably damaging	0.99
R2870:Arhgef10	UTSW	8	15,025,666 (GRCm39)	missense	probably benign	0.01
R2870:Arhgef10	UTSW	8	15,025,666 (GRCm39)	missense	probably benign	0.01
R2870:Arhgef10	UTSW	8	15,025,093 (GRCm39)	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	15,025,093 (GRCm39)	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	15,025,666 (GRCm39)	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	15,025,666 (GRCm39)	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	15,025,093 (GRCm39)	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	15,025,093 (GRCm39)	critical splice donor site	probably null
R2874:Arhgef10	UTSW	8	15,025,666 (GRCm39)	missense	probably benign	0.01
R2874:Arhgef10	UTSW	8	15,025,093 (GRCm39)	critical splice donor site	probably null
R3522:Arhgef10	UTSW	8	15,004,918 (GRCm39)	missense	probably damaging	1.00
R4049:Arhgef10	UTSW	8	15,029,998 (GRCm39)	missense	probably benign	0.05
R4324:Arhgef10	UTSW	8	14,990,335 (GRCm39)	missense	possibly damaging	0.77
R4351:Arhgef10	UTSW	8	15,041,145 (GRCm39)	nonsense	probably null
R4384:Arhgef10	UTSW	8	14,980,157 (GRCm39)	nonsense	probably null
R4385:Arhgef10	UTSW	8	14,980,157 (GRCm39)	nonsense	probably null
R4685:Arhgef10	UTSW	8	15,006,963 (GRCm39)	missense	probably damaging	1.00
R5111:Arhgef10	UTSW	8	14,982,408 (GRCm39)	missense	probably benign	0.00
R5169:Arhgef10	UTSW	8	14,980,051 (GRCm39)	missense	possibly damaging	0.80
R5670:Arhgef10	UTSW	8	15,004,774 (GRCm39)	missense	probably benign	0.01
R5945:Arhgef10	UTSW	8	15,030,028 (GRCm39)	critical splice donor site	probably null
R6593:Arhgef10	UTSW	8	15,012,564 (GRCm39)	missense	possibly damaging	0.82
R6593:Arhgef10	UTSW	8	15,012,522 (GRCm39)	missense	probably damaging	1.00
R6734:Arhgef10	UTSW	8	15,025,053 (GRCm39)	missense	probably damaging	1.00
R6859:Arhgef10	UTSW	8	15,025,005 (GRCm39)	missense	probably damaging	1.00
R6890:Arhgef10	UTSW	8	14,978,786 (GRCm39)	missense	probably benign	0.27
R7068:Arhgef10	UTSW	8	15,008,639 (GRCm39)	missense	probably damaging	1.00
R7081:Arhgef10	UTSW	8	15,047,547 (GRCm39)	nonsense	probably null
R7157:Arhgef10	UTSW	8	14,980,030 (GRCm39)	missense	probably damaging	1.00
R7232:Arhgef10	UTSW	8	14,990,323 (GRCm39)	missense	probably benign	0.10
R7514:Arhgef10	UTSW	8	15,025,956 (GRCm39)	missense	probably benign	0.16
R7544:Arhgef10	UTSW	8	15,029,854 (GRCm39)	missense	probably benign	0.34
R7657:Arhgef10	UTSW	8	15,029,893 (GRCm39)	missense	probably damaging	1.00
R7736:Arhgef10	UTSW	8	15,030,583 (GRCm39)	nonsense	probably null
R7777:Arhgef10	UTSW	8	14,995,373 (GRCm39)	missense	probably damaging	1.00
R8000:Arhgef10	UTSW	8	14,980,054 (GRCm39)	missense	probably damaging	1.00
R8060:Arhgef10	UTSW	8	15,004,446 (GRCm39)	missense	probably damaging	1.00
R8441:Arhgef10	UTSW	8	15,041,237 (GRCm39)	splice site	probably benign
R8545:Arhgef10	UTSW	8	15,025,931 (GRCm39)	missense	possibly damaging	0.83
R8545:Arhgef10	UTSW	8	14,978,868 (GRCm39)	missense	probably benign	0.00
R8702:Arhgef10	UTSW	8	14,992,638 (GRCm39)	missense	probably benign
R8846:Arhgef10	UTSW	8	15,025,956 (GRCm39)	missense	probably benign	0.16
R8854:Arhgef10	UTSW	8	15,029,798 (GRCm39)	critical splice acceptor site	probably null
R9076:Arhgef10	UTSW	8	15,024,993 (GRCm39)	missense	probably damaging	1.00
R9384:Arhgef10	UTSW	8	15,041,067 (GRCm39)	missense	probably damaging	0.99
R9479:Arhgef10	UTSW	8	15,047,632 (GRCm39)	missense	probably damaging	1.00
R9799:Arhgef10	UTSW	8	14,990,268 (GRCm39)	missense	probably damaging	0.99
X0024:Arhgef10	UTSW	8	15,028,486 (GRCm39)	missense	probably benign	0.01
X0027:Arhgef10	UTSW	8	15,047,631 (GRCm39)	missense	possibly damaging	0.92
Z1088:Arhgef10	UTSW	8	15,014,191 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GGTTAGTTAGCCCTGCACAG -3'
(R):5'- CTTTGGTCTGTGCTACAAGC -3'

Sequencing Primer
(F):5'- CAGGGAGGTTGCAAATGGCTTC -3'
(R):5'- TCTGTGCTACAAGCCCGGAC -3'

Posted On

2014-10-30