Incidental Mutation 'R2318:F11'
ID 245560
Institutional Source Beutler Lab
Gene Symbol F11
Ensembl Gene ENSMUSG00000031645
Gene Name coagulation factor XI
Synonyms FXI, plasma thromboplastin antecedent, Cf11, 1600027G01Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock # R2318 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 45241174-45262031 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 45248638 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 353 (S353P)
Ref Sequence ENSEMBL: ENSMUSP00000034064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034064]
AlphaFold Q91Y47
Predicted Effect probably damaging
Transcript: ENSMUST00000034064
AA Change: S353P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034064
Gene: ENSMUSG00000031645
AA Change: S353P

DomainStartEndE-ValueType
APPLE 20 103 2.89e-29 SMART
APPLE 110 193 1.02e-29 SMART
APPLE 200 283 2.29e-32 SMART
APPLE 291 376 1.04e-30 SMART
Tryp_SPc 389 617 1.54e-98 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210622
Meta Mutation Damage Score 0.5090 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that can be activated by coagulation factor XIIa, thrombin or factor XIa to generate active factor XIa protease. Mice lacking the encoded protein display a survival advantage during peritoneal sepsis and resist inflammation and bacterial accumulation upon infection with Listeria. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele show a tendency for slightly prolonged tail transection bleeding times and are protected from vessel-occluding fibrin formation after transient ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in F11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02008:F11 APN 8 45250095 missense probably damaging 1.00
IGL02096:F11 APN 8 45246754 missense probably benign 0.05
IGL02363:F11 APN 8 45241531 missense probably damaging 1.00
IGL02694:F11 APN 8 45252159 missense probably damaging 1.00
IGL03374:F11 APN 8 45261074 missense possibly damaging 0.63
R0225:F11 UTSW 8 45249077 missense probably benign 0.00
R0525:F11 UTSW 8 45253049 missense probably benign 0.01
R0842:F11 UTSW 8 45252159 missense probably damaging 1.00
R0961:F11 UTSW 8 45241494 missense probably damaging 1.00
R1605:F11 UTSW 8 45241580 missense probably damaging 1.00
R2044:F11 UTSW 8 45252118 missense probably benign 0.03
R2113:F11 UTSW 8 45246832 missense probably benign 0.00
R2273:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2274:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2275:F11 UTSW 8 45252147 missense possibly damaging 0.94
R2319:F11 UTSW 8 45248638 missense probably damaging 1.00
R2403:F11 UTSW 8 45248638 missense probably damaging 1.00
R2510:F11 UTSW 8 45248638 missense probably damaging 1.00
R2512:F11 UTSW 8 45261061 missense probably benign 0.01
R2893:F11 UTSW 8 45248638 missense probably damaging 1.00
R2894:F11 UTSW 8 45248638 missense probably damaging 1.00
R2910:F11 UTSW 8 45241449 makesense probably null
R3030:F11 UTSW 8 45248638 missense probably damaging 1.00
R3105:F11 UTSW 8 45245717 missense probably damaging 0.97
R3721:F11 UTSW 8 45248638 missense probably damaging 1.00
R3726:F11 UTSW 8 45248638 missense probably damaging 1.00
R3906:F11 UTSW 8 45248638 missense probably damaging 1.00
R3909:F11 UTSW 8 45248638 missense probably damaging 1.00
R4465:F11 UTSW 8 45241474 missense probably damaging 1.00
R4467:F11 UTSW 8 45241474 missense probably damaging 1.00
R4710:F11 UTSW 8 45250146 missense probably damaging 1.00
R4824:F11 UTSW 8 45255342 missense probably damaging 0.99
R4968:F11 UTSW 8 45245733 missense probably benign 0.19
R5225:F11 UTSW 8 45255304 missense probably benign 0.09
R5288:F11 UTSW 8 45246796 missense probably damaging 1.00
R5378:F11 UTSW 8 45252143 missense probably benign 0.19
R6155:F11 UTSW 8 45252082 missense probably damaging 1.00
R6213:F11 UTSW 8 45241500 missense probably damaging 1.00
R6615:F11 UTSW 8 45248774 missense probably benign
R6797:F11 UTSW 8 45253055 missense probably benign 0.02
R7147:F11 UTSW 8 45250146 missense probably damaging 1.00
R7683:F11 UTSW 8 45249508 missense probably damaging 0.97
R7688:F11 UTSW 8 45250090 missense probably damaging 1.00
R7720:F11 UTSW 8 45252090 missense possibly damaging 0.89
R8064:F11 UTSW 8 45245773 missense probably benign 0.01
R8273:F11 UTSW 8 45248607 missense possibly damaging 0.70
R8848:F11 UTSW 8 45242244 nonsense probably null
R8901:F11 UTSW 8 45248814 missense probably benign 0.01
R9141:F11 UTSW 8 45250055 critical splice donor site probably null
R9188:F11 UTSW 8 45245699 missense probably benign 0.00
U24488:F11 UTSW 8 45242312 missense probably benign 0.04
Z1088:F11 UTSW 8 45245772 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTCTCTATGGTTGTTGTAGACTAGCC -3'
(R):5'- AAGAGCTGGACATCGTCGATG -3'

Sequencing Primer
(F):5'- ACTAGCCTCGTGTAGTAGACTAGC -3'
(R):5'- CATCGTCGATGTGAAAGGCC -3'
Posted On 2014-10-30