Mutagenetix > Incidental Mutations

Incidental Mutation 'R2318:Mast1'

245561

Institutional Source

Beutler Lab

Gene Symbol

Mast1

Ensembl Gene

ENSMUSG00000053693

Gene Name

microtubule associated serine/threonine kinase 1

Synonyms

SAST170, SAST, 9430008B02Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84911903-84937359 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84921125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 540 (D540G)

Ref Sequence

ENSEMBL: ENSMUSP00000105363 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]

AlphaFold

Q9R1L5

Predicted Effect

probably damaging
Transcript: ENSMUST00000109741
AA Change: D540G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: D540G

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	337	1.4e-136	PFAM
S_TKc	376	649	4.07e-97	SMART
S_TK_X	650	710	6.23e-2	SMART
low complexity region	820	836	N/A	INTRINSIC
low complexity region	863	878	N/A	INTRINSIC
low complexity region	933	961	N/A	INTRINSIC
PDZ	977	1057	3.49e-14	SMART
low complexity region	1104	1132	N/A	INTRINSIC
low complexity region	1149	1174	N/A	INTRINSIC
low complexity region	1212	1224	N/A	INTRINSIC
low complexity region	1243	1252	N/A	INTRINSIC
low complexity region	1479	1492	N/A	INTRINSIC
low complexity region	1519	1535	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000119820
AA Change: D540G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: D540G

Domain	Start	End	E-Value	Type
Pfam:DUF1908	61	338	5.1e-148	PFAM
S_TKc	376	644	2.79e-86	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130923

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138221

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148573

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175085

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	G	11: 23,588,701	Y66H	probably damaging	Het
Arhgef10	G	A	8: 14,928,855	A41T	probably damaging	Het
Car15	T	C	16: 17,836,599	M158V	probably benign	Het
Cinp	C	A	12: 110,874,009	W113L	probably damaging	Het
Col4a3	T	A	1: 82,648,569		probably null	Het
Csnk2b	T	C	17: 35,118,061	Y101C	possibly damaging	Het
Ddb1	C	T	19: 10,626,628	R900C	probably damaging	Het
Eif4g2	A	G	7: 111,073,858	F876L	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Gm5868	T	C	5: 72,586,295	T27A	probably benign	Het
Hist1h4d	A	G	13: 23,581,756	Y52C	probably damaging	Het
Mis18bp1	C	T	12: 65,140,843	V829M	possibly damaging	Het
Mtus2	C	T	5: 148,107,082	R827*	probably null	Het
Nlrp9a	G	A	7: 26,573,852	V860M	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prr14l	T	C	5: 32,830,078	E691G	probably benign	Het
Rad1	A	G	15: 10,490,409	N154S	probably benign	Het
Smc2	T	C	4: 52,446,030	S133P	probably damaging	Het
Sstr1	T	A	12: 58,212,776	S62T	possibly damaging	Het
Thsd7a	T	C	6: 12,405,147	Y766C	probably damaging	Het
Timm44	A	G	8: 4,268,307	V129A	probably benign	Het
Tinag	T	C	9: 77,045,411	Y97C	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ubap2	A	G	4: 41,251,542	V30A	probably damaging	Het

Other mutations in Mast1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01395:Mast1	APN	8	84912815	missense	possibly damaging	0.87
IGL01862:Mast1	APN	8	84913246	splice site	probably null
IGL01918:Mast1	APN	8	84921209	missense	probably damaging	1.00
IGL02212:Mast1	APN	8	84921397	missense	probably damaging	1.00
IGL02221:Mast1	APN	8	84918755	missense	possibly damaging	0.92
IGL02370:Mast1	APN	8	84912254	missense	probably benign
IGL02470:Mast1	APN	8	84921212	missense	probably damaging	1.00
IGL02596:Mast1	APN	8	84917771	missense	probably benign
IGL02716:Mast1	APN	8	84935723	missense	probably damaging	1.00
IGL02987:Mast1	APN	8	84925719	missense	possibly damaging	0.75
IGL03287:Mast1	APN	8	84913353	missense	probably benign	0.01
R0255:Mast1	UTSW	8	84912021	missense	probably benign
R0388:Mast1	UTSW	8	84915537	missense	probably benign	0.13
R0480:Mast1	UTSW	8	84913089	missense	probably damaging	0.99
R0727:Mast1	UTSW	8	84921415	missense	probably damaging	1.00
R1175:Mast1	UTSW	8	84925327	missense	probably benign	0.29
R1297:Mast1	UTSW	8	84912716	missense	probably benign	0.05
R1328:Mast1	UTSW	8	84917988	intron	probably benign
R1454:Mast1	UTSW	8	84920635	missense	probably damaging	1.00
R1532:Mast1	UTSW	8	84928609	nonsense	probably null
R1752:Mast1	UTSW	8	84925336	missense	probably benign
R1777:Mast1	UTSW	8	84912068	missense	probably benign
R1905:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1906:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R1907:Mast1	UTSW	8	84916266	missense	probably damaging	1.00
R2056:Mast1	UTSW	8	84920366	missense	possibly damaging	0.95
R2071:Mast1	UTSW	8	84921194	missense	probably damaging	1.00
R2145:Mast1	UTSW	8	84921478	missense	probably damaging	1.00
R2842:Mast1	UTSW	8	84923908	missense	probably damaging	1.00
R3870:Mast1	UTSW	8	84918731	missense	probably damaging	1.00
R3895:Mast1	UTSW	8	84935723	missense	probably damaging	1.00
R3973:Mast1	UTSW	8	84918764	missense	probably damaging	1.00
R4405:Mast1	UTSW	8	84920891	missense	probably damaging	1.00
R4533:Mast1	UTSW	8	84921361	missense	probably damaging	1.00
R4725:Mast1	UTSW	8	84929006	missense	possibly damaging	0.93
R4770:Mast1	UTSW	8	84929246	missense	probably benign	0.02
R4776:Mast1	UTSW	8	84937193	critical splice donor site	probably null
R4835:Mast1	UTSW	8	84923779	missense	probably damaging	1.00
R4871:Mast1	UTSW	8	84920658	missense	probably damaging	1.00
R4953:Mast1	UTSW	8	84918728	missense	probably damaging	0.99
R4960:Mast1	UTSW	8	84917871	missense	probably benign
R4978:Mast1	UTSW	8	84935787	missense	probably damaging	0.98
R5164:Mast1	UTSW	8	84913518	unclassified	probably benign
R5235:Mast1	UTSW	8	84913439	missense	probably damaging	1.00
R5297:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R5463:Mast1	UTSW	8	84925507	missense	probably damaging	1.00
R5546:Mast1	UTSW	8	84916260	missense	probably damaging	1.00
R5651:Mast1	UTSW	8	84928968	nonsense	probably null
R6124:Mast1	UTSW	8	84925307	missense	probably benign	0.01
R6213:Mast1	UTSW	8	84915569	missense	probably damaging	1.00
R6717:Mast1	UTSW	8	84917754	missense	probably benign
R7000:Mast1	UTSW	8	84928969	missense	probably damaging	1.00
R7011:Mast1	UTSW	8	84911945	nonsense	probably null
R7164:Mast1	UTSW	8	84935304	missense	possibly damaging	0.81
R7695:Mast1	UTSW	8	84920928	missense	probably damaging	1.00
R7845:Mast1	UTSW	8	84925325	nonsense	probably null
R7882:Mast1	UTSW	8	84913318	critical splice donor site	probably null
R8167:Mast1	UTSW	8	84921358	missense	probably damaging	1.00
R8197:Mast1	UTSW	8	84912821	missense	possibly damaging	0.90
R8773:Mast1	UTSW	8	84916324	missense	probably damaging	1.00
X0066:Mast1	UTSW	8	84920878	missense	probably damaging	1.00
Z1176:Mast1	UTSW	8	84912459	missense	probably damaging	0.97
Z1176:Mast1	UTSW	8	84918681	missense	probably damaging	1.00
Z1177:Mast1	UTSW	8	84920446	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- GAGAATGATCCCCATAGCCC -3'
(R):5'- TCCCATTGTTCCTTGGAAGACC -3'

Sequencing Primer
(F):5'- ATGTACTCTGGGGTCCCACAC -3'
(R):5'- CCCAGGGGTGAAGGGCAAG -3'

Posted On

2014-10-30