Incidental Mutation 'R2318:Mast1'
ID 245561
Institutional Source Beutler Lab
Gene Symbol Mast1
Ensembl Gene ENSMUSG00000053693
Gene Name microtubule associated serine/threonine kinase 1
Synonyms 9430008B02Rik, SAST, SAST170
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2318 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 85638532-85663988 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 85647754 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 540 (D540G)
Ref Sequence ENSEMBL: ENSMUSP00000105363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109741] [ENSMUST00000119820]
AlphaFold Q9R1L5
Predicted Effect probably damaging
Transcript: ENSMUST00000109741
AA Change: D540G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105363
Gene: ENSMUSG00000053693
AA Change: D540G

DomainStartEndE-ValueType
Pfam:DUF1908 61 337 1.4e-136 PFAM
S_TKc 376 649 4.07e-97 SMART
S_TK_X 650 710 6.23e-2 SMART
low complexity region 820 836 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 933 961 N/A INTRINSIC
PDZ 977 1057 3.49e-14 SMART
low complexity region 1104 1132 N/A INTRINSIC
low complexity region 1149 1174 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1243 1252 N/A INTRINSIC
low complexity region 1479 1492 N/A INTRINSIC
low complexity region 1519 1535 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119820
AA Change: D540G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113547
Gene: ENSMUSG00000053693
AA Change: D540G

DomainStartEndE-ValueType
Pfam:DUF1908 61 338 5.1e-148 PFAM
S_TKc 376 644 2.79e-86 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153000
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175085
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10 G A 8: 14,978,855 (GRCm39) A41T probably damaging Het
Car15 T C 16: 17,654,463 (GRCm39) M158V probably benign Het
Cinp C A 12: 110,840,443 (GRCm39) W113L probably damaging Het
Col4a3 T A 1: 82,626,290 (GRCm39) probably null Het
Csnk2b T C 17: 35,337,037 (GRCm39) Y101C possibly damaging Het
Ddb1 C T 19: 10,603,992 (GRCm39) R900C probably damaging Het
Eif4g2 A G 7: 110,673,065 (GRCm39) F876L possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
H4c4 A G 13: 23,765,739 (GRCm39) Y52C probably damaging Het
Mis18bp1 C T 12: 65,187,617 (GRCm39) V829M possibly damaging Het
Mtus2 C T 5: 148,043,892 (GRCm39) R827* probably null Het
Nlrp9a G A 7: 26,273,277 (GRCm39) V860M probably damaging Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prr14l T C 5: 32,987,422 (GRCm39) E691G probably benign Het
Rad1 A G 15: 10,490,495 (GRCm39) N154S probably benign Het
Sanbr A G 11: 23,538,701 (GRCm39) Y66H probably damaging Het
Slc10a4-ps T C 5: 72,743,638 (GRCm39) T27A probably benign Het
Smc2 T C 4: 52,446,030 (GRCm39) S133P probably damaging Het
Sstr1 T A 12: 58,259,562 (GRCm39) S62T possibly damaging Het
Thsd7a T C 6: 12,405,146 (GRCm39) Y766C probably damaging Het
Timm44 A G 8: 4,318,307 (GRCm39) V129A probably benign Het
Tinag T C 9: 76,952,693 (GRCm39) Y97C probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ubap2 A G 4: 41,251,542 (GRCm39) V30A probably damaging Het
Other mutations in Mast1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Mast1 APN 8 85,639,444 (GRCm39) missense possibly damaging 0.87
IGL01862:Mast1 APN 8 85,639,875 (GRCm39) splice site probably null
IGL01918:Mast1 APN 8 85,647,838 (GRCm39) missense probably damaging 1.00
IGL02212:Mast1 APN 8 85,648,026 (GRCm39) missense probably damaging 1.00
IGL02221:Mast1 APN 8 85,645,384 (GRCm39) missense possibly damaging 0.92
IGL02370:Mast1 APN 8 85,638,883 (GRCm39) missense probably benign
IGL02470:Mast1 APN 8 85,647,841 (GRCm39) missense probably damaging 1.00
IGL02596:Mast1 APN 8 85,644,400 (GRCm39) missense probably benign
IGL02716:Mast1 APN 8 85,662,352 (GRCm39) missense probably damaging 1.00
IGL02987:Mast1 APN 8 85,652,348 (GRCm39) missense possibly damaging 0.75
IGL03287:Mast1 APN 8 85,639,982 (GRCm39) missense probably benign 0.01
R0255:Mast1 UTSW 8 85,638,650 (GRCm39) missense probably benign
R0388:Mast1 UTSW 8 85,642,166 (GRCm39) missense probably benign 0.13
R0480:Mast1 UTSW 8 85,639,718 (GRCm39) missense probably damaging 0.99
R0727:Mast1 UTSW 8 85,648,044 (GRCm39) missense probably damaging 1.00
R1175:Mast1 UTSW 8 85,651,956 (GRCm39) missense probably benign 0.29
R1297:Mast1 UTSW 8 85,639,345 (GRCm39) missense probably benign 0.05
R1328:Mast1 UTSW 8 85,644,617 (GRCm39) intron probably benign
R1454:Mast1 UTSW 8 85,647,264 (GRCm39) missense probably damaging 1.00
R1532:Mast1 UTSW 8 85,655,238 (GRCm39) nonsense probably null
R1752:Mast1 UTSW 8 85,651,965 (GRCm39) missense probably benign
R1777:Mast1 UTSW 8 85,638,697 (GRCm39) missense probably benign
R1905:Mast1 UTSW 8 85,642,895 (GRCm39) missense probably damaging 1.00
R1906:Mast1 UTSW 8 85,642,895 (GRCm39) missense probably damaging 1.00
R1907:Mast1 UTSW 8 85,642,895 (GRCm39) missense probably damaging 1.00
R2056:Mast1 UTSW 8 85,646,995 (GRCm39) missense possibly damaging 0.95
R2071:Mast1 UTSW 8 85,647,823 (GRCm39) missense probably damaging 1.00
R2145:Mast1 UTSW 8 85,648,107 (GRCm39) missense probably damaging 1.00
R2842:Mast1 UTSW 8 85,650,537 (GRCm39) missense probably damaging 1.00
R3870:Mast1 UTSW 8 85,645,360 (GRCm39) missense probably damaging 1.00
R3895:Mast1 UTSW 8 85,662,352 (GRCm39) missense probably damaging 1.00
R3973:Mast1 UTSW 8 85,645,393 (GRCm39) missense probably damaging 1.00
R4405:Mast1 UTSW 8 85,647,520 (GRCm39) missense probably damaging 1.00
R4533:Mast1 UTSW 8 85,647,990 (GRCm39) missense probably damaging 1.00
R4725:Mast1 UTSW 8 85,655,635 (GRCm39) missense possibly damaging 0.93
R4770:Mast1 UTSW 8 85,655,875 (GRCm39) missense probably benign 0.02
R4776:Mast1 UTSW 8 85,663,822 (GRCm39) critical splice donor site probably null
R4835:Mast1 UTSW 8 85,650,408 (GRCm39) missense probably damaging 1.00
R4871:Mast1 UTSW 8 85,647,287 (GRCm39) missense probably damaging 1.00
R4953:Mast1 UTSW 8 85,645,357 (GRCm39) missense probably damaging 0.99
R4960:Mast1 UTSW 8 85,644,500 (GRCm39) missense probably benign
R4978:Mast1 UTSW 8 85,662,416 (GRCm39) missense probably damaging 0.98
R5164:Mast1 UTSW 8 85,640,147 (GRCm39) unclassified probably benign
R5235:Mast1 UTSW 8 85,640,068 (GRCm39) missense probably damaging 1.00
R5297:Mast1 UTSW 8 85,639,947 (GRCm39) critical splice donor site probably null
R5463:Mast1 UTSW 8 85,652,136 (GRCm39) missense probably damaging 1.00
R5546:Mast1 UTSW 8 85,642,889 (GRCm39) missense probably damaging 1.00
R5651:Mast1 UTSW 8 85,655,597 (GRCm39) nonsense probably null
R6124:Mast1 UTSW 8 85,651,936 (GRCm39) missense probably benign 0.01
R6213:Mast1 UTSW 8 85,642,198 (GRCm39) missense probably damaging 1.00
R6717:Mast1 UTSW 8 85,644,383 (GRCm39) missense probably benign
R7000:Mast1 UTSW 8 85,655,598 (GRCm39) missense probably damaging 1.00
R7011:Mast1 UTSW 8 85,638,574 (GRCm39) nonsense probably null
R7164:Mast1 UTSW 8 85,661,933 (GRCm39) missense possibly damaging 0.81
R7695:Mast1 UTSW 8 85,647,557 (GRCm39) missense probably damaging 1.00
R7845:Mast1 UTSW 8 85,651,954 (GRCm39) nonsense probably null
R7882:Mast1 UTSW 8 85,639,947 (GRCm39) critical splice donor site probably null
R8167:Mast1 UTSW 8 85,647,987 (GRCm39) missense probably damaging 1.00
R8197:Mast1 UTSW 8 85,639,450 (GRCm39) missense possibly damaging 0.90
R8773:Mast1 UTSW 8 85,642,953 (GRCm39) missense probably damaging 1.00
R9477:Mast1 UTSW 8 85,638,779 (GRCm39) missense probably benign 0.18
R9526:Mast1 UTSW 8 85,647,805 (GRCm39) missense probably damaging 1.00
R9557:Mast1 UTSW 8 85,657,474 (GRCm39) missense probably damaging 1.00
R9655:Mast1 UTSW 8 85,650,660 (GRCm39) missense probably damaging 1.00
X0066:Mast1 UTSW 8 85,647,507 (GRCm39) missense probably damaging 1.00
Z1176:Mast1 UTSW 8 85,645,310 (GRCm39) missense probably damaging 1.00
Z1176:Mast1 UTSW 8 85,639,088 (GRCm39) missense probably damaging 0.97
Z1177:Mast1 UTSW 8 85,647,075 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GAGAATGATCCCCATAGCCC -3'
(R):5'- TCCCATTGTTCCTTGGAAGACC -3'

Sequencing Primer
(F):5'- ATGTACTCTGGGGTCCCACAC -3'
(R):5'- CCCAGGGGTGAAGGGCAAG -3'
Posted On 2014-10-30