Mutagenetix > Incidental Mutation

Incidental Mutation 'R2318:0610010F05Rik'

245564

Institutional Source

Beutler Lab

Gene Symbol

0610010F05Rik

Ensembl Gene

ENSMUSG00000042208

Gene Name

RIKEN cDNA 0610010F05 gene

Synonyms

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.115) question?

Stock #

R2318 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23564961-23633639 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 23588701 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 66 (Y66H)

Ref Sequence

ENSEMBL: ENSMUSP00000117103 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000093267] [ENSMUST00000109532] [ENSMUST00000123909] [ENSMUST00000155903] [ENSMUST00000180260]

AlphaFold

Q68FF0

Predicted Effect

probably damaging
Transcript: ENSMUST00000043356
AA Change: Y560H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208
AA Change: Y560H

Domain	Start	End	E-Value	Type
low complexity region	8	16	N/A	INTRINSIC
Pfam:DUF3342	147	449	5.1e-107	PFAM
low complexity region	565	576	N/A	INTRINSIC
low complexity region	579	596	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000093267
AA Change: Y414H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000090955
Gene: ENSMUSG00000042208
AA Change: Y414H

Domain	Start	End	E-Value	Type
Pfam:DUF3342	1	303	7.7e-107	PFAM
low complexity region	419	430	N/A	INTRINSIC
low complexity region	433	450	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109532
AA Change: Y560H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208
AA Change: Y560H

Domain	Start	End	E-Value	Type
low complexity region	8	16	N/A	INTRINSIC
Pfam:DUF3342	147	449	5.1e-107	PFAM
low complexity region	565	576	N/A	INTRINSIC
low complexity region	579	596	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000123909
AA Change: Y66H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117103
Gene: ENSMUSG00000042208
AA Change: Y66H

Domain	Start	End	E-Value	Type
low complexity region	71	82	N/A	INTRINSIC
low complexity region	85	102	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000155903
AA Change: Y560H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208
AA Change: Y560H

Domain	Start	End	E-Value	Type
low complexity region	8	16	N/A	INTRINSIC
Pfam:DUF3342	147	449	1e-106	PFAM
low complexity region	565	576	N/A	INTRINSIC
low complexity region	579	596	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000180260
AA Change: Y560H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208
AA Change: Y560H

Domain	Start	End	E-Value	Type
low complexity region	8	16	N/A	INTRINSIC
Pfam:DUF3342	147	449	4.5e-107	PFAM
low complexity region	565	576	N/A	INTRINSIC
low complexity region	579	596	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef10	G	A	8: 14,928,855	A41T	probably damaging	Het
Car15	T	C	16: 17,836,599	M158V	probably benign	Het
Cinp	C	A	12: 110,874,009	W113L	probably damaging	Het
Col4a3	T	A	1: 82,648,569		probably null	Het
Csnk2b	T	C	17: 35,118,061	Y101C	possibly damaging	Het
Ddb1	C	T	19: 10,626,628	R900C	probably damaging	Het
Eif4g2	A	G	7: 111,073,858	F876L	possibly damaging	Het
F11	A	G	8: 45,248,638	S353P	probably damaging	Het
Gm5868	T	C	5: 72,586,295	T27A	probably benign	Het
Hist1h4d	A	G	13: 23,581,756	Y52C	probably damaging	Het
Mast1	T	C	8: 84,921,125	D540G	probably damaging	Het
Mis18bp1	C	T	12: 65,140,843	V829M	possibly damaging	Het
Mtus2	C	T	5: 148,107,082	R827*	probably null	Het
Nlrp9a	G	A	7: 26,573,852	V860M	probably damaging	Het
Plod3	G	C	5: 136,988,146	A50P	probably benign	Het
Prr14l	T	C	5: 32,830,078	E691G	probably benign	Het
Rad1	A	G	15: 10,490,409	N154S	probably benign	Het
Smc2	T	C	4: 52,446,030	S133P	probably damaging	Het
Sstr1	T	A	12: 58,212,776	S62T	possibly damaging	Het
Thsd7a	T	C	6: 12,405,147	Y766C	probably damaging	Het
Timm44	A	G	8: 4,268,307	V129A	probably benign	Het
Tinag	T	C	9: 77,045,411	Y97C	probably damaging	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ubap2	A	G	4: 41,251,542	V30A	probably damaging	Het

Other mutations in 0610010F05Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01133:0610010F05Rik	APN	11	23595434	missense	probably damaging	1.00
IGL01444:0610010F05Rik	APN	11	23620225	splice site	probably benign
IGL01522:0610010F05Rik	APN	11	23582865	critical splice donor site	probably null
IGL01819:0610010F05Rik	APN	11	23584561	missense	probably benign	0.29
IGL02470:0610010F05Rik	APN	11	23615222	missense	probably damaging	0.99
IGL03046:0610010F05Rik	UTSW	11	23615150	missense	possibly damaging	0.77
R0139:0610010F05Rik	UTSW	11	23620214	splice site	probably benign
R0334:0610010F05Rik	UTSW	11	23617129	splice site	probably benign
R0646:0610010F05Rik	UTSW	11	23575491	missense	probably damaging	0.99
R1078:0610010F05Rik	UTSW	11	23611762	missense	probably benign	0.45
R1263:0610010F05Rik	UTSW	11	23620278	nonsense	probably null
R1471:0610010F05Rik	UTSW	11	23615222	missense	probably damaging	0.99
R1568:0610010F05Rik	UTSW	11	23589971	missense	probably damaging	1.00
R2163:0610010F05Rik	UTSW	11	23576826	splice site	probably benign
R2426:0610010F05Rik	UTSW	11	23576801	missense	probably damaging	1.00
R4373:0610010F05Rik	UTSW	11	23615265	splice site	probably null
R4688:0610010F05Rik	UTSW	11	23593449	missense	probably benign
R4816:0610010F05Rik	UTSW	11	23615243	missense	possibly damaging	0.67
R5046:0610010F05Rik	UTSW	11	23620354	missense	probably benign	0.23
R5156:0610010F05Rik	UTSW	11	23593424	critical splice donor site	probably null
R5249:0610010F05Rik	UTSW	11	23575483	makesense	probably null
R5615:0610010F05Rik	UTSW	11	23606759	missense	probably damaging	0.96
R6758:0610010F05Rik	UTSW	11	23588475	splice site	probably null
R6860:0610010F05Rik	UTSW	11	23625100	missense	probably damaging	1.00
R6910:0610010F05Rik	UTSW	11	23620447	missense	probably damaging	0.99
R7255:0610010F05Rik	UTSW	11	23620465	missense	probably benign	0.41
R7286:0610010F05Rik	UTSW	11	23622479	missense	probably benign	0.07
R7603:0610010F05Rik	UTSW	11	23566191	missense	probably benign
R7618:0610010F05Rik	UTSW	11	23584550	missense	possibly damaging	0.91
R7717:0610010F05Rik	UTSW	11	23606757	missense	probably benign	0.05
R8110:0610010F05Rik	UTSW	11	23576764	missense	probably benign
R8677:0610010F05Rik	UTSW	11	23595471	missense	probably benign	0.24
R9165:0610010F05Rik	UTSW	11	23615244	missense	probably benign	0.00
R9175:0610010F05Rik	UTSW	11	23584518	critical splice donor site	probably null
R9526:0610010F05Rik	UTSW	11	23609098	missense	probably damaging	1.00
R9583:0610010F05Rik	UTSW	11	23581642	missense	possibly damaging	0.69
R9622:0610010F05Rik	UTSW	11	23584590	missense	probably damaging	0.99
X0026:0610010F05Rik	UTSW	11	23576767	missense	probably benign	0.00
X0067:0610010F05Rik	UTSW	11	23593420	splice site	probably null
Z1177:0610010F05Rik	UTSW	11	23624960	missense	probably benign	0.38

Predicted Primers

PCR Primer
(F):5'- GAGCACCAGGGTTTATTTTCTC -3'
(R):5'- AGCCTCAAGTTTACCATACTTCTG -3'

Sequencing Primer
(F):5'- GCAAGCACCTTTACCTGATG -3'
(R):5'- ATGTGGATGCTGGCAATCCAC -3'

Posted On

2014-10-30