Incidental Mutation 'R2318:Sstr1'
ID245565
Institutional Source Beutler Lab
Gene Symbol Sstr1
Ensembl Gene ENSMUSG00000035431
Gene Namesomatostatin receptor 1
SynonymsSmstr-1, sst1, Smstr1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2318 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location58211772-58214444 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58212776 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 62 (S62T)
Ref Sequence ENSEMBL: ENSMUSP00000106299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044299] [ENSMUST00000110671]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044299
AA Change: S62T

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037045
Gene: ENSMUSG00000035431
AA Change: S62T

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 297 4.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 2.2e-65 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110671
AA Change: S62T

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106299
Gene: ENSMUSG00000035431
AA Change: S62T

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 299 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 4.1e-70 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display abnormal eye electrophysiology. Mice homozygous for a second targeted mutation display hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Sstr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sstr1 APN 12 58212750 missense probably benign
IGL01975:Sstr1 APN 12 58213626 missense probably benign 0.01
R0019:Sstr1 UTSW 12 58213149 missense probably damaging 1.00
R0019:Sstr1 UTSW 12 58213149 missense probably damaging 1.00
R0026:Sstr1 UTSW 12 58212858 missense probably damaging 1.00
R0083:Sstr1 UTSW 12 58213742 missense possibly damaging 0.85
R1218:Sstr1 UTSW 12 58213620 missense possibly damaging 0.68
R1254:Sstr1 UTSW 12 58213322 missense possibly damaging 0.93
R1815:Sstr1 UTSW 12 58213478 missense possibly damaging 0.81
R4588:Sstr1 UTSW 12 58213631 missense probably benign 0.00
R5041:Sstr1 UTSW 12 58213155 missense possibly damaging 0.94
R6556:Sstr1 UTSW 12 58213692 missense possibly damaging 0.94
R7332:Sstr1 UTSW 12 58213386 missense probably damaging 1.00
R7342:Sstr1 UTSW 12 58213670 missense possibly damaging 0.95
R7380:Sstr1 UTSW 12 58213280 missense probably benign 0.01
R7452:Sstr1 UTSW 12 58213356 missense probably damaging 1.00
R7873:Sstr1 UTSW 12 58213527 missense probably damaging 1.00
R7956:Sstr1 UTSW 12 58213527 missense probably damaging 1.00
Z1176:Sstr1 UTSW 12 58213526 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- CCACTTCAGCTGGGATGTTC -3'
(R):5'- ACATGTTGACCGCATCCACG -3'

Sequencing Primer
(F):5'- ATGTTCCCCAATGGCACCG -3'
(R):5'- CACCAGGCGGCAAAGTAGC -3'
Posted On2014-10-30