Incidental Mutation 'R2318:Cinp'
ID245567
Institutional Source Beutler Lab
Gene Symbol Cinp
Ensembl Gene ENSMUSG00000021276
Gene Namecyclin-dependent kinase 2 interacting protein
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2318 (G1)
Quality Score191
Status Not validated
Chromosome12
Chromosomal Location110872610-110889145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 110874009 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 113 (W113L)
Ref Sequence ENSEMBL: ENSMUSP00000152089 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043716] [ENSMUST00000170060] [ENSMUST00000220607] [ENSMUST00000221102] [ENSMUST00000221182] [ENSMUST00000222457]
Predicted Effect probably damaging
Transcript: ENSMUST00000043716
AA Change: W186L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035245
Gene: ENSMUSG00000021276
AA Change: W186L

DomainStartEndE-ValueType
low complexity region 54 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170060
SMART Domains Protein: ENSMUSP00000131841
Gene: ENSMUSG00000021271

DomainStartEndE-ValueType
low complexity region 271 278 N/A INTRINSIC
ZnF_C2H2 295 320 3.02e0 SMART
low complexity region 377 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220607
AA Change: W236L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220631
Predicted Effect probably benign
Transcript: ENSMUST00000221102
Predicted Effect probably damaging
Transcript: ENSMUST00000221182
AA Change: W113L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221901
Predicted Effect probably benign
Transcript: ENSMUST00000222457
Predicted Effect probably benign
Transcript: ENSMUST00000223170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223407
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the DNA replication complex as well as a genome-maintenance protein. It may interact with proteins important for replication initiation and has been shown to bind chromatin at the G1 phase of the cell cycle and dissociate from chromatin with replication initiation. It may also serve to regulate checkpoint signaling as part of the DNA damage response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Cinp
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4812:Cinp UTSW 12 110879740 missense probably damaging 1.00
R4908:Cinp UTSW 12 110884053 missense probably damaging 0.99
R5209:Cinp UTSW 12 110874060 missense probably benign 0.03
R5303:Cinp UTSW 12 110876861 missense probably damaging 1.00
R7635:Cinp UTSW 12 110884013 missense possibly damaging 0.64
R7867:Cinp UTSW 12 110874123 missense probably benign 0.06
R7950:Cinp UTSW 12 110874123 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTGGAGCTTCATGACACCC -3'
(R):5'- AAGGACAGTGCTTTCTCACG -3'

Sequencing Primer
(F):5'- GGACCCTCAAAGTATCTGGCCTTG -3'
(R):5'- AGTGCTTTCTCACGCAGCC -3'
Posted On2014-10-30