Incidental Mutation 'R2318:Hist1h4d'
ID245568
Institutional Source Beutler Lab
Gene Symbol Hist1h4d
Ensembl Gene ENSMUSG00000061482
Gene Namehistone cluster 1, H4d
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R2318 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23581598-23582735 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23581756 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 52 (Y52C)
Ref Sequence ENSEMBL: ENSMUSP00000100033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051091] [ENSMUST00000091704] [ENSMUST00000102968] [ENSMUST00000105105]
Predicted Effect probably benign
Transcript: ENSMUST00000051091
SMART Domains Protein: ENSMUSP00000061247
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000091704
SMART Domains Protein: ENSMUSP00000089296
Gene: ENSMUSG00000047246

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
H2B 28 124 1.43e-72 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102968
AA Change: Y52C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100033
Gene: ENSMUSG00000061482
AA Change: Y52C

DomainStartEndE-ValueType
H4 16 90 2.59e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105105
SMART Domains Protein: ENSMUSP00000100737
Gene: ENSMUSG00000099583

DomainStartEndE-ValueType
H3 34 136 2.12e-75 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails but instead contain a palindromic termination element. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Hist1h4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5558:Hist1h4d UTSW 13 23581796 missense possibly damaging 0.92
R5650:Hist1h4d UTSW 13 23581795 missense possibly damaging 0.60
R5753:Hist1h4d UTSW 13 23581604 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TTTCAAACAGGTCCGCATTG -3'
(R):5'- AAATGAGTACGTTTAGCCGCC -3'

Sequencing Primer
(F):5'- AAGGCCGCTTGTTACAGTCAC -3'
(R):5'- AGTACGTTTAGCCGCCGAATC -3'
Posted On2014-10-30