Incidental Mutation 'R2318:Rad1'
ID 245569
Institutional Source Beutler Lab
Gene Symbol Rad1
Ensembl Gene ENSMUSG00000022248
Gene Name RAD1 checkpoint DNA exonuclease
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock # R2318 (G1)
Quality Score 96
Status Not validated
Chromosome 15
Chromosomal Location 10486018-10499063 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10490409 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 154 (N154S)
Ref Sequence ENSEMBL: ENSMUSP00000098338 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022855] [ENSMUST00000022856] [ENSMUST00000100775] [ENSMUST00000168408] [ENSMUST00000168761] [ENSMUST00000169050] [ENSMUST00000169519] [ENSMUST00000170100]
AlphaFold Q9QWZ1
Predicted Effect probably benign
Transcript: ENSMUST00000022855
SMART Domains Protein: ENSMUSP00000022855
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Brix 63 243 3.62e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022856
AA Change: N154S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022856
Gene: ENSMUSG00000022248
AA Change: N154S

DomainStartEndE-ValueType
Pfam:Rad1 16 257 2.2e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100775
AA Change: N154S

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000098338
Gene: ENSMUSG00000022248
AA Change: N154S

DomainStartEndE-ValueType
Pfam:Rad1 16 235 5.5e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168408
SMART Domains Protein: ENSMUSP00000132747
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 67 1.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168761
SMART Domains Protein: ENSMUSP00000130602
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Blast:Brix 10 51 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000169050
SMART Domains Protein: ENSMUSP00000127437
Gene: ENSMUSG00000022247

DomainStartEndE-ValueType
Pfam:Brix 72 154 8.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169519
SMART Domains Protein: ENSMUSP00000126645
Gene: ENSMUSG00000022248

DomainStartEndE-ValueType
Pfam:Rad1 16 133 9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170100
AA Change: N124S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000128601
Gene: ENSMUSG00000022248
AA Change: N124S

DomainStartEndE-ValueType
Pfam:Rad1 1 161 1.3e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170531
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a heterotrimeric cell cycle checkpoint complex, known as the 9-1-1 complex, that is activated to stop cell cycle progression in response to DNA damage or incomplete DNA replication. The 9-1-1 complex is recruited by RAD17 to affected sites where it may attract specialized DNA polymerases and other DNA repair effectors. Alternatively spliced transcript variants of this gene have been described. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit normal B cell DNA damage sensitivity, somatic hypermutation, and class switch recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Rad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Rad1 APN 15 10490409 missense probably benign 0.06
IGL01536:Rad1 APN 15 10493200 missense possibly damaging 0.94
IGL01544:Rad1 APN 15 10490379 missense probably damaging 0.99
IGL02058:Rad1 APN 15 10493275 missense probably benign 0.01
IGL02368:Rad1 APN 15 10493251 missense probably benign 0.19
IGL02793:Rad1 APN 15 10493279 missense probably benign 0.00
IGL02875:Rad1 APN 15 10493279 missense probably benign 0.00
R0271:Rad1 UTSW 15 10490457 splice site probably null
R1874:Rad1 UTSW 15 10488006 missense probably damaging 1.00
R2154:Rad1 UTSW 15 10486635 missense possibly damaging 0.77
R2369:Rad1 UTSW 15 10486659 missense probably damaging 1.00
R2875:Rad1 UTSW 15 10490331 missense probably benign 0.09
R2876:Rad1 UTSW 15 10490331 missense probably benign 0.09
R2915:Rad1 UTSW 15 10486642 missense probably damaging 0.99
R3721:Rad1 UTSW 15 10488026 missense probably benign 0.00
R4754:Rad1 UTSW 15 10493126 intron probably benign
R4931:Rad1 UTSW 15 10492762 intron probably benign
R5274:Rad1 UTSW 15 10487973 splice site probably null
R5640:Rad1 UTSW 15 10495923 missense possibly damaging 0.47
R5885:Rad1 UTSW 15 10488057 missense probably damaging 1.00
R6056:Rad1 UTSW 15 10488074 missense probably damaging 0.99
R6341:Rad1 UTSW 15 10492821 missense probably damaging 0.99
R6420:Rad1 UTSW 15 10488012 missense probably benign 0.00
R7068:Rad1 UTSW 15 10490293 nonsense probably null
R7205:Rad1 UTSW 15 10493257 missense probably benign 0.00
R7312:Rad1 UTSW 15 10493281 missense probably benign 0.00
R7817:Rad1 UTSW 15 10493318 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCATTTGGAGGGAACGCTAAC -3'
(R):5'- TGCAACTCAAGCAAATGTTGTG -3'

Sequencing Primer
(F):5'- TAGAGCTAAGCCCCATGTGC -3'
(R):5'- CTCAAGCAAATGTTGTGTGGAG -3'
Posted On 2014-10-30