Incidental Mutation 'R0279:Ddx10'
Institutional Source Beutler Lab
Gene Symbol Ddx10
Ensembl Gene ENSMUSG00000053289
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 10
MMRRC Submission 038501-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R0279 (G1)
Quality Score216
Status Validated
Chromosomal Location53098635-53248053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53235304 bp
Amino Acid Change Aspartic acid to Glycine at position 206 (D206G)
Ref Sequence ENSEMBL: ENSMUSP00000065198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065630]
Predicted Effect probably damaging
Transcript: ENSMUST00000065630
AA Change: D206G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065198
Gene: ENSMUSG00000053289
AA Change: D206G

low complexity region 24 43 N/A INTRINSIC
DEXDc 88 291 1.74e-53 SMART
HELICc 327 410 8.48e-25 SMART
DUF4217 450 513 6.06e-25 SMART
low complexity region 577 594 N/A INTRINSIC
low complexity region 627 637 N/A INTRINSIC
low complexity region 658 680 N/A INTRINSIC
low complexity region 748 773 N/A INTRINSIC
Meta Mutation Damage Score 0.6937 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 95.1%
  • 20x: 89.6%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it may be involved in ribosome assembly. Fusion of this gene and the nucleoporin gene, NUP98, by inversion 11 (p15q22) chromosome translocation is found in the patients with de novo or therapy-related myeloid malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit craniofacial defects, including decreased cranium length, cleft palate, and short snout, and show reduced body size, body weight, lean body mass, and bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610528J11Rik A T 4: 118,529,293 M1L probably benign Het
5730596B20Rik T A 6: 52,179,202 probably benign Het
Acrbp T C 6: 125,053,954 probably null Het
Acss3 A G 10: 107,084,871 I126T possibly damaging Het
Aff3 T C 1: 38,535,569 E110G probably damaging Het
Aldh1a3 T C 7: 66,409,252 I113V probably benign Het
Aplp2 T C 9: 31,157,790 E525G probably damaging Het
Atp2b4 A G 1: 133,729,702 probably benign Het
Atp8a1 C T 5: 67,813,092 probably null Het
Bhmt A G 13: 93,625,464 C104R probably damaging Het
Ccdc151 A G 9: 21,990,247 probably benign Het
Cct5 T G 15: 31,591,031 E508A probably damaging Het
Celsr1 T A 15: 85,902,864 E2761D probably benign Het
Clstn1 T C 4: 149,643,674 S600P probably damaging Het
Cnppd1 A G 1: 75,136,929 S232P probably damaging Het
Crybb3 T C 5: 113,079,753 probably null Het
Csmd1 A G 8: 16,223,235 I861T probably damaging Het
Cyp2d10 A C 15: 82,405,339 S191A possibly damaging Het
Dnah1 G T 14: 31,302,375 H916N possibly damaging Het
Dnah9 A G 11: 65,911,789 probably null Het
Epb42 G A 2: 121,029,044 probably benign Het
Etnppl A G 3: 130,629,413 R248G probably damaging Het
Eya3 T C 4: 132,719,247 F369L probably damaging Het
Fam129a T C 1: 151,709,206 probably null Het
Fam170b T C 14: 32,834,068 probably benign Het
Fli1 A T 9: 32,461,427 V105D probably damaging Het
Fmo1 T C 1: 162,830,272 I433M possibly damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Foxe3 T C 4: 114,925,568 D149G probably damaging Het
Gk5 T C 9: 96,174,804 probably benign Het
Gm14226 A G 2: 155,025,452 D443G possibly damaging Het
Gm9796 C T 11: 95,697,995 noncoding transcript Het
Golga4 A T 9: 118,568,993 R52S probably benign Het
Hey2 C A 10: 30,834,010 C249F probably damaging Het
Ipo9 A T 1: 135,420,363 probably benign Het
Ireb2 C A 9: 54,886,593 T269K probably benign Het
Kansl3 A G 1: 36,351,969 V274A probably damaging Het
Kcnk2 C T 1: 189,209,972 A352T possibly damaging Het
Lamc2 T C 1: 153,130,696 E903G probably benign Het
Lepr A G 4: 101,750,344 K253R probably benign Het
Lmntd2 T C 7: 141,213,623 probably benign Het
Lrrc39 A T 3: 116,578,303 T240S probably benign Het
Lrrc43 A G 5: 123,497,022 probably null Het
Maf T C 8: 115,705,756 M370V possibly damaging Het
Mib2 G A 4: 155,661,216 S46L possibly damaging Het
Mms22l C T 4: 24,497,867 T63I probably damaging Het
Morc2a T A 11: 3,683,989 S700R probably benign Het
Mpz A G 1: 171,159,929 probably benign Het
Ncam2 T C 16: 81,623,337 probably benign Het
Nudt14 C T 12: 112,938,417 A123T probably damaging Het
Olfr1016 A T 2: 85,799,535 I245N possibly damaging Het
Olfr13 G A 6: 43,174,758 M257I probably benign Het
Olfr239 C T 17: 33,199,324 T92I probably benign Het
Otoa T C 7: 121,111,079 probably benign Het
Pik3cg G A 12: 32,204,791 T399I probably damaging Het
Pkn3 C T 2: 30,083,297 A377V probably benign Het
Ppan A G 9: 20,891,529 N327S probably benign Het
Prkca T C 11: 108,054,111 probably benign Het
Prrc2c A T 1: 162,715,464 V320E probably damaging Het
Ptprq A G 10: 107,608,417 V1442A probably damaging Het
Rapgef1 C T 2: 29,726,227 R834C probably damaging Het
Rbms1 G T 2: 60,842,410 N44K probably damaging Het
Rfwd3 A C 8: 111,282,733 F404V probably benign Het
Rimbp3 G T 16: 17,209,453 R247L probably benign Het
Serpinb1b T C 13: 33,093,713 S310P possibly damaging Het
Smtn C A 11: 3,530,235 V329L probably damaging Het
Snapc2 T C 8: 4,254,979 probably benign Het
Spam1 A T 6: 24,800,419 M386L probably benign Het
Syne2 A G 12: 76,095,613 E6208G probably damaging Het
Teddm1a T C 1: 153,892,623 Y278H probably damaging Het
Tnfaip6 A T 2: 52,055,916 N258I possibly damaging Het
Trpm4 C T 7: 45,322,048 R188Q probably damaging Het
Ttbk2 A T 2: 120,748,960 H491Q probably benign Het
Urgcp C T 11: 5,716,989 E450K probably benign Het
Vmn1r228 T C 17: 20,776,375 N294D probably benign Het
Wdfy3 A T 5: 101,868,092 C2606S probably damaging Het
Wdr33 T A 18: 31,888,324 H642Q unknown Het
Zbtb46 A G 2: 181,411,774 S382P possibly damaging Het
Zfp217 A G 2: 170,119,780 I209T probably benign Het
Zranb3 T A 1: 127,963,773 N822I probably benign Het
Other mutations in Ddx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ddx10 APN 9 53160026 splice site probably benign
IGL01111:Ddx10 APN 9 53159948 missense possibly damaging 0.73
IGL01773:Ddx10 APN 9 53204130 missense possibly damaging 0.94
IGL01837:Ddx10 APN 9 53229198 missense probably benign 0.16
IGL02036:Ddx10 APN 9 53204183 missense probably benign 0.00
IGL02236:Ddx10 APN 9 53235382 missense probably damaging 1.00
IGL02939:Ddx10 APN 9 53204279 missense possibly damaging 0.63
IGL03294:Ddx10 APN 9 53117152 critical splice donor site probably null
R1439:Ddx10 UTSW 9 53240487 missense probably damaging 1.00
R1501:Ddx10 UTSW 9 53233997 missense possibly damaging 0.85
R1529:Ddx10 UTSW 9 53117199 nonsense probably null
R1548:Ddx10 UTSW 9 53149561 critical splice acceptor site probably null
R1717:Ddx10 UTSW 9 53159953 missense probably benign 0.25
R1720:Ddx10 UTSW 9 53238071 missense probably damaging 1.00
R1781:Ddx10 UTSW 9 53207545 missense probably damaging 1.00
R2005:Ddx10 UTSW 9 53240475 critical splice donor site probably null
R2007:Ddx10 UTSW 9 53213278 missense probably benign 0.06
R2073:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2075:Ddx10 UTSW 9 53240505 missense probably benign 0.28
R2133:Ddx10 UTSW 9 53149512 missense probably benign 0.13
R4660:Ddx10 UTSW 9 53236398 critical splice donor site probably null
R4668:Ddx10 UTSW 9 53099213 missense possibly damaging 0.55
R4706:Ddx10 UTSW 9 53233931 missense probably damaging 1.00
R4814:Ddx10 UTSW 9 53204105 missense possibly damaging 0.54
R5394:Ddx10 UTSW 9 53233857 nonsense probably null
R5655:Ddx10 UTSW 9 53209687 critical splice donor site probably null
R5874:Ddx10 UTSW 9 53229198 missense possibly damaging 0.95
R6341:Ddx10 UTSW 9 53204251 missense probably benign 0.00
R6534:Ddx10 UTSW 9 53223688 missense probably damaging 1.00
R6801:Ddx10 UTSW 9 53247907 nonsense probably null
R6994:Ddx10 UTSW 9 53204111 missense probably damaging 0.99
R7155:Ddx10 UTSW 9 53117288 missense probably benign 0.00
R7380:Ddx10 UTSW 9 53240486 missense probably damaging 1.00
R7753:Ddx10 UTSW 9 53225604 missense probably damaging 1.00
X0019:Ddx10 UTSW 9 53233996 missense probably damaging 1.00
X0063:Ddx10 UTSW 9 53225573 missense probably damaging 1.00
Z1177:Ddx10 UTSW 9 53204511 missense probably damaging 0.98
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gaactgaaagggaaaagtggtg -3'
Posted On2013-04-16