Incidental Mutation 'R2318:Car15'
ID 245571
Institutional Source Beutler Lab
Gene Symbol Car15
Ensembl Gene ENSMUSG00000090236
Gene Name carbonic anhydrase 15
Synonyms Cals2
Accession Numbers

Genbank: NM_030558; MGI: 1931324  

Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock # R2318 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 17835276-17838364 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17836599 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 158 (M158V)
Ref Sequence ENSEMBL: ENSMUSP00000113400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012152] [ENSMUST00000066127] [ENSMUST00000117082] [ENSMUST00000117945] [ENSMUST00000118960] [ENSMUST00000150068]
AlphaFold Q99N23
Predicted Effect probably benign
Transcript: ENSMUST00000012152
SMART Domains Protein: ENSMUSP00000012152
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066127
SMART Domains Protein: ENSMUSP00000064603
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
transmembrane domain 274 296 N/A INTRINSIC
low complexity region 298 306 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117082
SMART Domains Protein: ENSMUSP00000113506
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 5.86e-11 SMART
CLECT 113 264 1.06e-14 SMART
VWC 269 330 1.42e-9 SMART
transmembrane domain 344 366 N/A INTRINSIC
low complexity region 368 376 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117945
SMART Domains Protein: ENSMUSP00000112783
Gene: ENSMUSG00000003166

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
VWC 267 328 1.42e-9 SMART
transmembrane domain 342 364 N/A INTRINSIC
low complexity region 366 374 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118960
AA Change: M158V

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000113400
Gene: ENSMUSG00000090236
AA Change: M158V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Carb_anhydrase 25 293 2.31e-106 SMART
low complexity region 307 320 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135229
Predicted Effect probably benign
Transcript: ENSMUST00000150068
SMART Domains Protein: ENSMUSP00000115071
Gene: ENSMUSG00000092470

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 559 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232529
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Csnk2b T C 17: 35,118,061 Y101C possibly damaging Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Car15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00822:Car15 APN 16 17836634 missense probably damaging 1.00
IGL01292:Car15 APN 16 17835529 missense probably damaging 1.00
IGL01361:Car15 APN 16 17837854 missense probably damaging 1.00
IGL03061:Car15 APN 16 17835385 missense possibly damaging 0.59
R0383:Car15 UTSW 16 17836753 nonsense probably null
R0544:Car15 UTSW 16 17835816 splice site probably benign
R1771:Car15 UTSW 16 17836866 missense probably damaging 0.97
R1951:Car15 UTSW 16 17837405 missense possibly damaging 0.47
R2910:Car15 UTSW 16 17838142 unclassified probably benign
R4370:Car15 UTSW 16 17835435 missense probably damaging 0.99
R4843:Car15 UTSW 16 17836608 missense possibly damaging 0.60
R5110:Car15 UTSW 16 17835347 missense possibly damaging 0.53
R6251:Car15 UTSW 16 17837363 missense probably benign 0.09
R6360:Car15 UTSW 16 17838066 missense probably benign 0.01
R6699:Car15 UTSW 16 17836574 missense probably null 0.43
R7127:Car15 UTSW 16 17838196 unclassified probably benign
R7567:Car15 UTSW 16 17836788 missense probably damaging 1.00
R8289:Car15 UTSW 16 17836716 critical splice donor site probably null
R8543:Car15 UTSW 16 17836849 missense probably benign 0.00
R9252:Car15 UTSW 16 17835382 nonsense probably null
X0026:Car15 UTSW 16 17835532 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GCAGTGAGCTCTTCTGAGTTC -3'
(R):5'- CTTCGAGTAAATTCCTGTCAGCAG -3'

Sequencing Primer
(F):5'- CAGTGAGCTCTTCTGAGTTCTCTAAG -3'
(R):5'- TCACCAGAGTACCGGCTACTG -3'
Posted On 2014-10-30