Incidental Mutation 'R2318:Csnk2b'
ID245572
Institutional Source Beutler Lab
Gene Symbol Csnk2b
Ensembl Gene ENSMUSG00000024387
Gene Namecasein kinase 2, beta polypeptide
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2318 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35116196-35122053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35118061 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 101 (Y101C)
Ref Sequence ENSEMBL: ENSMUSP00000134673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025246] [ENSMUST00000052167] [ENSMUST00000062657] [ENSMUST00000165306] [ENSMUST00000172765] [ENSMUST00000172854] [ENSMUST00000173043] [ENSMUST00000173114] [ENSMUST00000173380] [ENSMUST00000173915] [ENSMUST00000174024] [ENSMUST00000174306] [ENSMUST00000174779]
Predicted Effect probably benign
Transcript: ENSMUST00000025246
AA Change: Y101C

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000025246
Gene: ENSMUSG00000024387
AA Change: Y101C

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052167
SMART Domains Protein: ENSMUSP00000056646
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 82 99 N/A INTRINSIC
ANK 156 186 4.36e-1 SMART
G_patch 269 315 1.45e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062657
SMART Domains Protein: ENSMUSP00000052133
Gene: ENSMUSG00000043807

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CK_II_beta 21 115 1e-40 BLAST
Blast:CK_II_beta 125 170 3e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000165306
SMART Domains Protein: ENSMUSP00000133240
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 4.36e-1 SMART
G_patch 246 292 1.45e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172765
AA Change: Y122C

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134523
Gene: ENSMUSG00000024387
AA Change: Y122C

DomainStartEndE-ValueType
CK_II_beta 29 206 6.86e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172854
SMART Domains Protein: ENSMUSP00000138033
Gene: ENSMUSG00000043807

DomainStartEndE-ValueType
Blast:CK_II_beta 1 60 2e-18 BLAST
Blast:CK_II_beta 70 115 1e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173043
SMART Domains Protein: ENSMUSP00000135684
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
ANK 133 163 2.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173114
AA Change: Y101C

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134218
Gene: ENSMUSG00000024387
AA Change: Y101C

DomainStartEndE-ValueType
CK_II_beta 8 191 9.99e-143 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173189
Predicted Effect probably benign
Transcript: ENSMUST00000173380
SMART Domains Protein: ENSMUSP00000134694
Gene: ENSMUSG00000092417

DomainStartEndE-ValueType
low complexity region 59 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173576
Predicted Effect unknown
Transcript: ENSMUST00000173633
AA Change: Y4C
SMART Domains Protein: ENSMUSP00000133826
Gene: ENSMUSG00000024387
AA Change: Y4C

DomainStartEndE-ValueType
CK_II_beta 2 91 1.28e-26 SMART
Blast:CK_II_beta 121 154 4e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173915
SMART Domains Protein: ENSMUSP00000133425
Gene: ENSMUSG00000024387

DomainStartEndE-ValueType
CK_II_beta 8 58 6.45e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174024
AA Change: Y101C

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134673
Gene: ENSMUSG00000024387
AA Change: Y101C

DomainStartEndE-ValueType
CK_II_beta 8 169 5.07e-71 SMART
Blast:CK_II_beta 189 220 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174306
AA Change: Y101C

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134413
Gene: ENSMUSG00000024387
AA Change: Y101C

DomainStartEndE-ValueType
CK_II_beta 8 122 3.01e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174779
AA Change: Y50C

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000133684
Gene: ENSMUSG00000024387
AA Change: Y50C

DomainStartEndE-ValueType
CK_II_beta 1 140 2.47e-83 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177018
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the casein kinase 2 enzyme, which is a heterotetramer comprised of alpha and/or alpha-prime catalytic subunits and two regulatory beta subunits. Casein kinase 2 is involved in the regulation of several cellular processes including gene expression, protein synthesis and cell proliferation. Knockout of this gene in mice leads to embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit embryonic lethality post-implantation, growth retardation and arrest, a failure to form an inner cell mass and smaller size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A G 11: 23,588,701 Y66H probably damaging Het
Arhgef10 G A 8: 14,928,855 A41T probably damaging Het
Car15 T C 16: 17,836,599 M158V probably benign Het
Cinp C A 12: 110,874,009 W113L probably damaging Het
Col4a3 T A 1: 82,648,569 probably null Het
Ddb1 C T 19: 10,626,628 R900C probably damaging Het
Eif4g2 A G 7: 111,073,858 F876L possibly damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm5868 T C 5: 72,586,295 T27A probably benign Het
Hist1h4d A G 13: 23,581,756 Y52C probably damaging Het
Mast1 T C 8: 84,921,125 D540G probably damaging Het
Mis18bp1 C T 12: 65,140,843 V829M possibly damaging Het
Mtus2 C T 5: 148,107,082 R827* probably null Het
Nlrp9a G A 7: 26,573,852 V860M probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prr14l T C 5: 32,830,078 E691G probably benign Het
Rad1 A G 15: 10,490,409 N154S probably benign Het
Smc2 T C 4: 52,446,030 S133P probably damaging Het
Sstr1 T A 12: 58,212,776 S62T possibly damaging Het
Thsd7a T C 6: 12,405,147 Y766C probably damaging Het
Timm44 A G 8: 4,268,307 V129A probably benign Het
Tinag T C 9: 77,045,411 Y97C probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ubap2 A G 4: 41,251,542 V30A probably damaging Het
Other mutations in Csnk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Csnk2b APN 17 35118016 missense possibly damaging 0.92
R6966:Csnk2b UTSW 17 35117782 missense probably benign
R7053:Csnk2b UTSW 17 35116446 intron probably benign
R7693:Csnk2b UTSW 17 35117996 missense probably null 1.00
R7812:Csnk2b UTSW 17 35120455 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AGAGTTTCACCATGGCCTC -3'
(R):5'- AATAGCAAATGGCCCCTGGG -3'

Sequencing Primer
(F):5'- CTCGCCTGGGATGTCTGAAAG -3'
(R):5'- TCTAGTCAGAAGTGGGAGAC -3'
Posted On2014-10-30