Incidental Mutation 'R2318:Ddb1'
ID 245573
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Name damage specific DNA binding protein 1
Synonyms damage-specific DNA-binding protein, DNA repair, p127-Ddb1, DNA repair protein
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2318 (G1)
Quality Score 175
Status Not validated
Chromosome 19
Chromosomal Location 10582961-10607186 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 10603992 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 900 (R900C)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649]
AlphaFold Q3U1J4
Predicted Effect probably damaging
Transcript: ENSMUST00000025649
AA Change: R900C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: R900C

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef10 G A 8: 14,978,855 (GRCm39) A41T probably damaging Het
Car15 T C 16: 17,654,463 (GRCm39) M158V probably benign Het
Cinp C A 12: 110,840,443 (GRCm39) W113L probably damaging Het
Col4a3 T A 1: 82,626,290 (GRCm39) probably null Het
Csnk2b T C 17: 35,337,037 (GRCm39) Y101C possibly damaging Het
Eif4g2 A G 7: 110,673,065 (GRCm39) F876L possibly damaging Het
F11 A G 8: 45,701,675 (GRCm39) S353P probably damaging Het
H4c4 A G 13: 23,765,739 (GRCm39) Y52C probably damaging Het
Mast1 T C 8: 85,647,754 (GRCm39) D540G probably damaging Het
Mis18bp1 C T 12: 65,187,617 (GRCm39) V829M possibly damaging Het
Mtus2 C T 5: 148,043,892 (GRCm39) R827* probably null Het
Nlrp9a G A 7: 26,273,277 (GRCm39) V860M probably damaging Het
Plod3 G C 5: 137,017,000 (GRCm39) A50P probably benign Het
Prr14l T C 5: 32,987,422 (GRCm39) E691G probably benign Het
Rad1 A G 15: 10,490,495 (GRCm39) N154S probably benign Het
Sanbr A G 11: 23,538,701 (GRCm39) Y66H probably damaging Het
Slc10a4-ps T C 5: 72,743,638 (GRCm39) T27A probably benign Het
Smc2 T C 4: 52,446,030 (GRCm39) S133P probably damaging Het
Sstr1 T A 12: 58,259,562 (GRCm39) S62T possibly damaging Het
Thsd7a T C 6: 12,405,146 (GRCm39) Y766C probably damaging Het
Timm44 A G 8: 4,318,307 (GRCm39) V129A probably benign Het
Tinag T C 9: 76,952,693 (GRCm39) Y97C probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Ubap2 A G 4: 41,251,542 (GRCm39) V30A probably damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10,589,028 (GRCm39) missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10,588,124 (GRCm39) missense probably benign
IGL01161:Ddb1 APN 19 10,583,071 (GRCm39) start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10,605,024 (GRCm39) critical splice donor site probably null
IGL01804:Ddb1 APN 19 10,590,382 (GRCm39) missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10,590,382 (GRCm39) missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10,604,996 (GRCm39) missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10,599,830 (GRCm39) missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10,585,247 (GRCm39) missense probably benign
IGL03033:Ddb1 APN 19 10,603,290 (GRCm39) missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10,590,309 (GRCm39) missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10,590,309 (GRCm39) missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10,599,225 (GRCm39) missense probably benign 0.01
Dubitable UTSW 19 10,599,863 (GRCm39) critical splice donor site probably null
Indubitable UTSW 19 10,585,275 (GRCm39) critical splice donor site probably null
Van_der_waals UTSW 19 10,590,280 (GRCm39) missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10,603,334 (GRCm39) missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10,596,610 (GRCm39) missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10,599,080 (GRCm39) missense probably benign 0.02
R0893:Ddb1 UTSW 19 10,590,280 (GRCm39) missense probably benign 0.11
R1374:Ddb1 UTSW 19 10,585,682 (GRCm39) missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10,604,128 (GRCm39) critical splice donor site probably null
R1611:Ddb1 UTSW 19 10,590,252 (GRCm39) missense probably damaging 1.00
R1661:Ddb1 UTSW 19 10,606,444 (GRCm39) missense probably benign 0.00
R1835:Ddb1 UTSW 19 10,603,957 (GRCm39) missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10,588,186 (GRCm39) splice site probably benign
R2094:Ddb1 UTSW 19 10,590,300 (GRCm39) missense probably benign
R2142:Ddb1 UTSW 19 10,596,490 (GRCm39) critical splice donor site probably null
R2213:Ddb1 UTSW 19 10,585,691 (GRCm39) missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10,584,337 (GRCm39) missense probably benign 0.03
R3150:Ddb1 UTSW 19 10,590,346 (GRCm39) missense probably benign 0.02
R3162:Ddb1 UTSW 19 10,603,335 (GRCm39) missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10,603,335 (GRCm39) missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10,605,857 (GRCm39) missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10,605,171 (GRCm39) missense probably benign 0.00
R5157:Ddb1 UTSW 19 10,599,728 (GRCm39) missense probably benign 0.01
R6244:Ddb1 UTSW 19 10,603,287 (GRCm39) missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10,583,084 (GRCm39) nonsense probably null
R6812:Ddb1 UTSW 19 10,599,863 (GRCm39) critical splice donor site probably null
R7337:Ddb1 UTSW 19 10,605,195 (GRCm39) missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10,585,275 (GRCm39) critical splice donor site probably null
R7737:Ddb1 UTSW 19 10,603,338 (GRCm39) missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10,585,712 (GRCm39) missense probably benign 0.12
R8288:Ddb1 UTSW 19 10,585,712 (GRCm39) missense probably benign 0.12
R8376:Ddb1 UTSW 19 10,596,669 (GRCm39) missense probably damaging 1.00
R8970:Ddb1 UTSW 19 10,585,808 (GRCm39) missense probably benign 0.01
R9720:Ddb1 UTSW 19 10,585,724 (GRCm39) missense probably benign
RF016:Ddb1 UTSW 19 10,605,222 (GRCm39) missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10,604,023 (GRCm39) missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10,596,594 (GRCm39) missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10,585,760 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTCTGTAGTAAGGTATGTCC -3'
(R):5'- CATTGTATATAAGTCTGGACCCAAG -3'

Sequencing Primer
(F):5'- ATGAACCAACCTTTATTTTCCTTAGC -3'
(R):5'- AAGTCCCGGGCACTACCTC -3'
Posted On 2014-10-30