Incidental Mutation 'R2319:Gnat3'
ID245578
Institutional Source Beutler Lab
Gene Symbol Gnat3
Ensembl Gene ENSMUSG00000028777
Gene Nameguanine nucleotide binding protein, alpha transducing 3
SynonymsGtn, Ggust, alpha-gustducin
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2319 (G1)
Quality Score211
Status Not validated
Chromosome5
Chromosomal Location17962549-18019834 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 18019626 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 341 (D341E)
Ref Sequence ENSEMBL: ENSMUSP00000030561 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030561]
Predicted Effect probably benign
Transcript: ENSMUST00000030561
AA Change: D341E

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030561
Gene: ENSMUSG00000028777
AA Change: D341E

DomainStartEndE-ValueType
G_alpha 13 353 3.06e-221 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sweet, bitter, and umami tastes are transmitted from taste receptors by a specific guanine nucleotide binding protein. The protein encoded by this gene is the alpha subunit of this heterotrimeric G protein, which is found not only in the oral epithelium but also in gut tissues. Variations in this gene have been linked to metabolic syndrome. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal taste sensitivity. Mice show reduced behavioral and electrophysiological responses to bitter, sweet, and unami compounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Atp11a T A 8: 12,847,505 H273Q probably damaging Het
Ccdc186 A G 19: 56,797,567 S679P possibly damaging Het
Chac2 T A 11: 30,986,252 probably benign Het
Col6a5 T C 9: 105,937,218 T532A unknown Het
Dsg1c A T 18: 20,275,178 Y428F probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam129c T C 8: 71,602,764 F273L probably benign Het
Gm7489 A T 15: 53,885,049 probably benign Het
Lrpprc G A 17: 84,726,390 P1020S probably benign Het
Nlrp4a A G 7: 26,449,894 S309G probably benign Het
Pik3cg T C 12: 32,176,736 I1051V probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rmnd1 A G 10: 4,422,099 V200A possibly damaging Het
Rrbp1 T C 2: 143,957,559 N1076S probably benign Het
Rtn4 A G 11: 29,707,154 D436G probably benign Het
Spta1 A G 1: 174,178,656 probably null Het
Srsf3 G A 17: 29,038,546 R88Q unknown Het
Stxbp2 T C 8: 3,633,834 I90T possibly damaging Het
Tnr T A 1: 159,850,048 M1K probably null Het
Tns3 G A 11: 8,541,200 S119L probably damaging Het
Vmn1r2 A G 4: 3,172,083 M1V probably null Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Gnat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gnat3 APN 5 18003751 splice site probably benign
IGL01023:Gnat3 APN 5 18003828 missense probably damaging 1.00
IGL01997:Gnat3 APN 5 17999723 nonsense probably null
PIT4377001:Gnat3 UTSW 5 18015559 missense
R0556:Gnat3 UTSW 5 18019598 missense probably damaging 1.00
R1624:Gnat3 UTSW 5 18003843 missense possibly damaging 0.66
R1934:Gnat3 UTSW 5 18019510 missense possibly damaging 0.74
R3928:Gnat3 UTSW 5 18003894 splice site probably benign
R4169:Gnat3 UTSW 5 18003864 missense probably damaging 1.00
R4420:Gnat3 UTSW 5 17999801 missense probably damaging 1.00
R4632:Gnat3 UTSW 5 18015366 splice site probably null
R4651:Gnat3 UTSW 5 18015570 missense probably damaging 1.00
R4652:Gnat3 UTSW 5 18015570 missense probably damaging 1.00
R5471:Gnat3 UTSW 5 17991324 missense probably damaging 1.00
R7460:Gnat3 UTSW 5 17999658 missense
R7627:Gnat3 UTSW 5 17999748 missense
R7637:Gnat3 UTSW 5 18003772 missense
X0064:Gnat3 UTSW 5 18003840 missense possibly damaging 0.74
Z1088:Gnat3 UTSW 5 18015323 missense probably damaging 1.00
Z1177:Gnat3 UTSW 5 18015313 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACCTTGGACACATTGACTTTG -3'
(R):5'- CCGAATCCTGATATATGTGACACC -3'

Sequencing Primer
(F):5'- CCTTGGACACATTGACTTTGAAATTG -3'
(R):5'- GTGACACCACAGTAACATTTTTGTG -3'
Posted On2014-10-30