Incidental Mutation 'R2319:Fam129c'
ID245585
Institutional Source Beutler Lab
Gene Symbol Fam129c
Ensembl Gene ENSMUSG00000043243
Gene Namefamily with sequence similarity 129, member C
SynonymsBcnp1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2319 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71597648-71607936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71602764 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 273 (F273L)
Ref Sequence ENSEMBL: ENSMUSP00000123432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125339] [ENSMUST00000126559] [ENSMUST00000127626] [ENSMUST00000143662]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124485
Predicted Effect probably benign
Transcript: ENSMUST00000125339
SMART Domains Protein: ENSMUSP00000119708
Gene: ENSMUSG00000043243

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 110 119 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125525
Predicted Effect probably benign
Transcript: ENSMUST00000126559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127285
Predicted Effect probably benign
Transcript: ENSMUST00000127626
SMART Domains Protein: ENSMUSP00000122042
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 18 214 7.2e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141594
Predicted Effect probably benign
Transcript: ENSMUST00000143662
AA Change: F273L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000123432
Gene: ENSMUSG00000043243
AA Change: F273L

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
PH 68 196 4.94e-4 SMART
low complexity region 218 230 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Atp11a T A 8: 12,847,505 H273Q probably damaging Het
Ccdc186 A G 19: 56,797,567 S679P possibly damaging Het
Chac2 T A 11: 30,986,252 probably benign Het
Col6a5 T C 9: 105,937,218 T532A unknown Het
Dsg1c A T 18: 20,275,178 Y428F probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Gm7489 A T 15: 53,885,049 probably benign Het
Gnat3 T G 5: 18,019,626 D341E probably benign Het
Lrpprc G A 17: 84,726,390 P1020S probably benign Het
Nlrp4a A G 7: 26,449,894 S309G probably benign Het
Pik3cg T C 12: 32,176,736 I1051V probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rmnd1 A G 10: 4,422,099 V200A possibly damaging Het
Rrbp1 T C 2: 143,957,559 N1076S probably benign Het
Rtn4 A G 11: 29,707,154 D436G probably benign Het
Spta1 A G 1: 174,178,656 probably null Het
Srsf3 G A 17: 29,038,546 R88Q unknown Het
Stxbp2 T C 8: 3,633,834 I90T possibly damaging Het
Tnr T A 1: 159,850,048 M1K probably null Het
Tns3 G A 11: 8,541,200 S119L probably damaging Het
Vmn1r2 A G 4: 3,172,083 M1V probably null Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Fam129c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Fam129c APN 8 71604863 splice site probably benign
IGL01530:Fam129c APN 8 71603917 splice site probably benign
IGL01553:Fam129c APN 8 71602902 missense possibly damaging 0.86
IGL02313:Fam129c APN 8 71602860 missense possibly damaging 0.92
IGL02341:Fam129c APN 8 71603799 missense possibly damaging 0.60
IGL02541:Fam129c APN 8 71602782 missense probably benign 0.07
IGL02745:Fam129c APN 8 71605038 splice site probably null
R0006:Fam129c UTSW 8 71605044 splice site probably benign
R0391:Fam129c UTSW 8 71602499 splice site probably benign
R0594:Fam129c UTSW 8 71599135 missense probably benign 0.07
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1643:Fam129c UTSW 8 71600164 missense probably benign 0.34
R1848:Fam129c UTSW 8 71603769 missense possibly damaging 0.95
R1986:Fam129c UTSW 8 71603760 missense possibly damaging 0.63
R4386:Fam129c UTSW 8 71607511 intron probably benign
R4564:Fam129c UTSW 8 71605060 intron probably benign
R4666:Fam129c UTSW 8 71603825 nonsense probably null
R6341:Fam129c UTSW 8 71600077 missense probably damaging 1.00
R6364:Fam129c UTSW 8 71599089 missense probably benign 0.08
R6888:Fam129c UTSW 8 71603739 missense probably benign
R6890:Fam129c UTSW 8 71605671 missense probably damaging 1.00
R7383:Fam129c UTSW 8 71603826 missense possibly damaging 0.86
R7441:Fam129c UTSW 8 71600164 missense probably benign 0.34
R7459:Fam129c UTSW 8 71605027 missense possibly damaging 0.75
R7527:Fam129c UTSW 8 71606698 missense probably damaging 0.99
R7873:Fam129c UTSW 8 71602248 missense probably damaging 1.00
R7956:Fam129c UTSW 8 71602248 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGGGCCTTCAGTCCTG -3'
(R):5'- TTAATAAACATGTCCCTCGGCCC -3'

Sequencing Primer
(F):5'- TGCTGCTCTATCGACGACG -3'
(R):5'- TCAGGGGATTCCTAGCTCCAC -3'
Posted On2014-10-30