Incidental Mutation 'R2319:Rmnd1'
ID245588
Institutional Source Beutler Lab
Gene Symbol Rmnd1
Ensembl Gene ENSMUSG00000019763
Gene Namerequired for meiotic nuclear division 1 homolog
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R2319 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location4401915-4432388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4422099 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 200 (V200A)
Ref Sequence ENSEMBL: ENSMUSP00000043355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042251]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042251
AA Change: V200A

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000043355
Gene: ENSMUSG00000019763
AA Change: V200A

DomainStartEndE-ValueType
Pfam:DUF155 227 404 3.2e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156940
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the evolutionary conserved sif2 family of proteins that share the DUF155 domain in common. This protein is thought to be localized in the mitochondria and involved in mitochondrial translation. Mutations in this gene are associated with combined oxidative phosphorylation deficiency-11. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Atp11a T A 8: 12,847,505 H273Q probably damaging Het
Ccdc186 A G 19: 56,797,567 S679P possibly damaging Het
Chac2 T A 11: 30,986,252 probably benign Het
Col6a5 T C 9: 105,937,218 T532A unknown Het
Dsg1c A T 18: 20,275,178 Y428F probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam129c T C 8: 71,602,764 F273L probably benign Het
Gm7489 A T 15: 53,885,049 probably benign Het
Gnat3 T G 5: 18,019,626 D341E probably benign Het
Lrpprc G A 17: 84,726,390 P1020S probably benign Het
Nlrp4a A G 7: 26,449,894 S309G probably benign Het
Pik3cg T C 12: 32,176,736 I1051V probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rrbp1 T C 2: 143,957,559 N1076S probably benign Het
Rtn4 A G 11: 29,707,154 D436G probably benign Het
Spta1 A G 1: 174,178,656 probably null Het
Srsf3 G A 17: 29,038,546 R88Q unknown Het
Stxbp2 T C 8: 3,633,834 I90T possibly damaging Het
Tnr T A 1: 159,850,048 M1K probably null Het
Tns3 G A 11: 8,541,200 S119L probably damaging Het
Vmn1r2 A G 4: 3,172,083 M1V probably null Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Rmnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Rmnd1 APN 10 4427392 missense probably benign
IGL01018:Rmnd1 APN 10 4427290 missense probably benign 0.43
IGL01112:Rmnd1 APN 10 4410793 unclassified probably null
R0418:Rmnd1 UTSW 10 4427693 critical splice acceptor site probably null
R2036:Rmnd1 UTSW 10 4407884 missense probably damaging 1.00
R2312:Rmnd1 UTSW 10 4427466 missense probably benign
R4191:Rmnd1 UTSW 10 4410809 unclassified probably benign
R5077:Rmnd1 UTSW 10 4427488 missense possibly damaging 0.66
R5620:Rmnd1 UTSW 10 4422159 missense probably damaging 1.00
R5659:Rmnd1 UTSW 10 4427382 missense probably benign 0.04
R6291:Rmnd1 UTSW 10 4422135 missense probably damaging 1.00
R7089:Rmnd1 UTSW 10 4403873 missense probably damaging 1.00
R7214:Rmnd1 UTSW 10 4410753 missense probably benign
R7260:Rmnd1 UTSW 10 4414803 intron probably null
R7540:Rmnd1 UTSW 10 4403989 missense probably damaging 1.00
R7599:Rmnd1 UTSW 10 4413404 missense probably benign 0.11
R7719:Rmnd1 UTSW 10 4427496 missense probably benign
R7777:Rmnd1 UTSW 10 4411713 missense probably damaging 1.00
R7809:Rmnd1 UTSW 10 4407848 missense probably damaging 1.00
X0026:Rmnd1 UTSW 10 4427676 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- TCTTCTCAAGTGACAGTGATCC -3'
(R):5'- CTTTGCAGAGTAGAGTTCCCTAGTG -3'

Sequencing Primer
(F):5'- TGGCTTTGAACTCACTGAGACCAG -3'
(R):5'- CTAGTGGGGTCCAGCTACCATTG -3'
Posted On2014-10-30