Incidental Mutation 'R2319:Rtn4'
ID245591
Institutional Source Beutler Lab
Gene Symbol Rtn4
Ensembl Gene ENSMUSG00000020458
Gene Namereticulon 4
SynonymsNOGO, C130026I10Rik, NgA, 1110020G17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R2319 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29692947-29744331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29707154 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 436 (D436G)
Ref Sequence ENSEMBL: ENSMUSP00000099907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078830] [ENSMUST00000102841] [ENSMUST00000102842] [ENSMUST00000102843] [ENSMUST00000170731]
Predicted Effect probably benign
Transcript: ENSMUST00000078830
SMART Domains Protein: ENSMUSP00000077875
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102841
AA Change: D320G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000099905
Gene: ENSMUSG00000020458
AA Change: D320G

DomainStartEndE-ValueType
low complexity region 102 110 N/A INTRINSIC
Pfam:Reticulon 859 1029 6.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102842
SMART Domains Protein: ENSMUSP00000099906
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 188 358 4.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102843
AA Change: D436G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000099907
Gene: ENSMUSG00000020458
AA Change: D436G

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
low complexity region 218 226 N/A INTRINSIC
Pfam:Reticulon 975 1139 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170731
SMART Domains Protein: ENSMUSP00000126413
Gene: ENSMUSG00000020458

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 85 100 N/A INTRINSIC
low complexity region 109 129 N/A INTRINSIC
low complexity region 134 160 N/A INTRINSIC
Pfam:Reticulon 169 339 4.2e-58 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the A and B isoforms are viable and one line shows enhanced regeneration and recovery after spinal cord injury. Different lines of mice lacking isoforms A, B, and C show varying phenotypes. Whereas some produce viable homozygotes, others are embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Atp11a T A 8: 12,847,505 H273Q probably damaging Het
Ccdc186 A G 19: 56,797,567 S679P possibly damaging Het
Chac2 T A 11: 30,986,252 probably benign Het
Col6a5 T C 9: 105,937,218 T532A unknown Het
Dsg1c A T 18: 20,275,178 Y428F probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam129c T C 8: 71,602,764 F273L probably benign Het
Gm7489 A T 15: 53,885,049 probably benign Het
Gnat3 T G 5: 18,019,626 D341E probably benign Het
Lrpprc G A 17: 84,726,390 P1020S probably benign Het
Nlrp4a A G 7: 26,449,894 S309G probably benign Het
Pik3cg T C 12: 32,176,736 I1051V probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rmnd1 A G 10: 4,422,099 V200A possibly damaging Het
Rrbp1 T C 2: 143,957,559 N1076S probably benign Het
Spta1 A G 1: 174,178,656 probably null Het
Srsf3 G A 17: 29,038,546 R88Q unknown Het
Stxbp2 T C 8: 3,633,834 I90T possibly damaging Het
Tnr T A 1: 159,850,048 M1K probably null Het
Tns3 G A 11: 8,541,200 S119L probably damaging Het
Vmn1r2 A G 4: 3,172,083 M1V probably null Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Rtn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Rtn4 APN 11 29707291 missense probably damaging 1.00
IGL02187:Rtn4 APN 11 29708291 missense possibly damaging 0.78
IGL02475:Rtn4 APN 11 29733801 missense probably damaging 1.00
IGL02751:Rtn4 APN 11 29706409 critical splice acceptor site probably null
R0063:Rtn4 UTSW 11 29705527 intron probably benign
R0110:Rtn4 UTSW 11 29733849 splice site probably benign
R0510:Rtn4 UTSW 11 29733849 splice site probably benign
R0653:Rtn4 UTSW 11 29707256 missense probably damaging 1.00
R0658:Rtn4 UTSW 11 29706475 missense probably damaging 1.00
R1353:Rtn4 UTSW 11 29707595 missense probably damaging 1.00
R1384:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1406:Rtn4 UTSW 11 29708236 missense probably benign 0.21
R1873:Rtn4 UTSW 11 29736437 missense probably damaging 1.00
R1960:Rtn4 UTSW 11 29736464 missense probably damaging 1.00
R1980:Rtn4 UTSW 11 29708634 missense probably benign 0.00
R2888:Rtn4 UTSW 11 29693687 missense probably damaging 0.98
R3150:Rtn4 UTSW 11 29693308 small deletion probably benign
R3403:Rtn4 UTSW 11 29707690 missense probably benign 0.12
R3974:Rtn4 UTSW 11 29707505 missense probably damaging 1.00
R3977:Rtn4 UTSW 11 29693819 missense probably benign 0.01
R4223:Rtn4 UTSW 11 29706856 missense probably benign 0.02
R4725:Rtn4 UTSW 11 29708362 missense probably damaging 1.00
R4801:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4802:Rtn4 UTSW 11 29708660 missense probably benign 0.21
R4974:Rtn4 UTSW 11 29740994 missense probably damaging 1.00
R4983:Rtn4 UTSW 11 29707217 missense probably benign 0.43
R5292:Rtn4 UTSW 11 29707924 missense probably benign 0.39
R5332:Rtn4 UTSW 11 29733645 missense probably damaging 1.00
R5551:Rtn4 UTSW 11 29741011 missense probably damaging 1.00
R5604:Rtn4 UTSW 11 29708140 missense probably damaging 0.97
R6046:Rtn4 UTSW 11 29708023 missense probably damaging 1.00
R6928:Rtn4 UTSW 11 29706791 missense possibly damaging 0.92
R7386:Rtn4 UTSW 11 29707772 missense probably damaging 1.00
R7743:Rtn4 UTSW 11 29733790 nonsense probably null
R7784:Rtn4 UTSW 11 29741048 nonsense probably null
R7832:Rtn4 UTSW 11 29741048 nonsense probably null
R7846:Rtn4 UTSW 11 29693274 missense unknown
R7896:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
R7915:Rtn4 UTSW 11 29741048 nonsense probably null
R7929:Rtn4 UTSW 11 29693274 missense unknown
R7979:Rtn4 UTSW 11 29705536 missense probably damaging 1.00
RF006:Rtn4 UTSW 11 29706919 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCCATTTGAACAAGCATGGG -3'
(R):5'- TGCCTCAGAATCATGTATTGCTAC -3'

Sequencing Primer
(F):5'- CCATTTGAACAAGCATGGGAAGTG -3'
(R):5'- TTGCTACAAGGAAAGGATTTGAC -3'
Posted On2014-10-30