Incidental Mutation 'R2319:Gm7489'
ID245595
Institutional Source Beutler Lab
Gene Symbol Gm7489
Ensembl Gene ENSMUSG00000072584
Gene Namepredicted gene 7489
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2319 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location53884906-53886597 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 53885049 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078673] [ENSMUST00000100666] [ENSMUST00000132059]
Predicted Effect probably benign
Transcript: ENSMUST00000078673
SMART Domains Protein: ENSMUSP00000077741
Gene: ENSMUSG00000058656

DomainStartEndE-ValueType
SAM 74 143 1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100666
Predicted Effect probably benign
Transcript: ENSMUST00000132059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154119
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Atp11a T A 8: 12,847,505 H273Q probably damaging Het
Ccdc186 A G 19: 56,797,567 S679P possibly damaging Het
Chac2 T A 11: 30,986,252 probably benign Het
Col6a5 T C 9: 105,937,218 T532A unknown Het
Dsg1c A T 18: 20,275,178 Y428F probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam129c T C 8: 71,602,764 F273L probably benign Het
Gnat3 T G 5: 18,019,626 D341E probably benign Het
Lrpprc G A 17: 84,726,390 P1020S probably benign Het
Nlrp4a A G 7: 26,449,894 S309G probably benign Het
Pik3cg T C 12: 32,176,736 I1051V probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rmnd1 A G 10: 4,422,099 V200A possibly damaging Het
Rrbp1 T C 2: 143,957,559 N1076S probably benign Het
Rtn4 A G 11: 29,707,154 D436G probably benign Het
Spta1 A G 1: 174,178,656 probably null Het
Srsf3 G A 17: 29,038,546 R88Q unknown Het
Stxbp2 T C 8: 3,633,834 I90T possibly damaging Het
Tnr T A 1: 159,850,048 M1K probably null Het
Tns3 G A 11: 8,541,200 S119L probably damaging Het
Vmn1r2 A G 4: 3,172,083 M1V probably null Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Gm7489
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4458001:Gm7489 UTSW 15 53885799 missense unknown
R4852:Gm7489 UTSW 15 53886038 intron probably benign
R5212:Gm7489 UTSW 15 53885620 intron probably benign
R6778:Gm7489 UTSW 15 53885952 intron probably benign
R7832:Gm7489 UTSW 15 53886006 missense unknown
R7915:Gm7489 UTSW 15 53886006 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGAAGTGTTACTTATTCAGCC -3'
(R):5'- AGACAGACCACTGAATAGTCATGG -3'

Sequencing Primer
(F):5'- CGAAGTGTTACTTATTCAGCCTCATG -3'
(R):5'- GCACATTGTATGTTTAAACCGAAG -3'
Posted On2014-10-30