Incidental Mutation 'R2319:Srsf3'
ID245596
Institutional Source Beutler Lab
Gene Symbol Srsf3
Ensembl Gene ENSMUSG00000071172
Gene Nameserine/arginine-rich splicing factor 3
SynonymsX16, Sfrs3
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2319 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location29032673-29043366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29038546 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 88 (R88Q)
Ref Sequence ENSEMBL: ENSMUSP00000117045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037776] [ENSMUST00000130216]
Predicted Effect unknown
Transcript: ENSMUST00000037776
AA Change: R88Q
SMART Domains Protein: ENSMUSP00000049025
Gene: ENSMUSG00000071172
AA Change: R88Q

DomainStartEndE-ValueType
RRM 11 79 2.74e-21 SMART
low complexity region 86 114 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130216
AA Change: R88Q
SMART Domains Protein: ENSMUSP00000117045
Gene: ENSMUSG00000071172
AA Change: R88Q

DomainStartEndE-ValueType
RRM 11 79 2.74e-21 SMART
low complexity region 86 143 N/A INTRINSIC
low complexity region 148 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150157
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous mutant mice die at early embryonic stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Atp11a T A 8: 12,847,505 H273Q probably damaging Het
Ccdc186 A G 19: 56,797,567 S679P possibly damaging Het
Chac2 T A 11: 30,986,252 probably benign Het
Col6a5 T C 9: 105,937,218 T532A unknown Het
Dsg1c A T 18: 20,275,178 Y428F probably damaging Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam129c T C 8: 71,602,764 F273L probably benign Het
Gm7489 A T 15: 53,885,049 probably benign Het
Gnat3 T G 5: 18,019,626 D341E probably benign Het
Lrpprc G A 17: 84,726,390 P1020S probably benign Het
Nlrp4a A G 7: 26,449,894 S309G probably benign Het
Pik3cg T C 12: 32,176,736 I1051V probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Rmnd1 A G 10: 4,422,099 V200A possibly damaging Het
Rrbp1 T C 2: 143,957,559 N1076S probably benign Het
Rtn4 A G 11: 29,707,154 D436G probably benign Het
Spta1 A G 1: 174,178,656 probably null Het
Stxbp2 T C 8: 3,633,834 I90T possibly damaging Het
Tnr T A 1: 159,850,048 M1K probably null Het
Tns3 G A 11: 8,541,200 S119L probably damaging Het
Vmn1r2 A G 4: 3,172,083 M1V probably null Het
Vpreb3 C T 10: 75,943,222 probably benign Het
Other mutations in Srsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02284:Srsf3 APN 17 29036457 splice site probably benign
R0964:Srsf3 UTSW 17 29036438 missense probably damaging 1.00
R0964:Srsf3 UTSW 17 29036439 missense probably damaging 1.00
R3880:Srsf3 UTSW 17 29036283 missense probably damaging 1.00
R3962:Srsf3 UTSW 17 29036456 splice site probably benign
R3963:Srsf3 UTSW 17 29036456 splice site probably benign
Predicted Primers PCR Primer
(F):5'- ACTTAGAGCAAGTGGGCCTG -3'
(R):5'- CGATGTCCACAGTAAGTTAACCC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GTAAGTTAACCCACCAACAACCTTAG -3'
Posted On2014-10-30