Incidental Mutation 'R2320:Olfr344'
ID245602
Institutional Source Beutler Lab
Gene Symbol Olfr344
Ensembl Gene ENSMUSG00000096822
Gene Nameolfactory receptor 344
SynonymsGA_x6K02T2NLDC-33262744-33263673, MOR136-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location36566662-36576178 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36568625 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 9 (V9E)
Ref Sequence ENSEMBL: ENSMUSP00000151202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075474] [ENSMUST00000215879]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075474
AA Change: V9E

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074919
Gene: ENSMUSG00000096822
AA Change: V9E

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-56 PFAM
Pfam:7tm_1 41 290 2.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215879
AA Change: V9E

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.3726 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Olfr344
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Olfr344 APN 2 36568826 missense probably damaging 1.00
IGL01450:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01452:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01458:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01466:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01470:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01476:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01477:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01478:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01480:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01481:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01487:Olfr344 APN 2 36568742 missense probably damaging 1.00
IGL01522:Olfr344 APN 2 36569221 missense probably benign 0.00
IGL02141:Olfr344 APN 2 36568808 missense probably damaging 1.00
IGL02510:Olfr344 APN 2 36568681 missense possibly damaging 0.87
IGL02896:Olfr344 APN 2 36569205 missense possibly damaging 0.88
IGL03032:Olfr344 APN 2 36568704 nonsense probably null
R0081:Olfr344 UTSW 2 36568881 nonsense probably null
R0581:Olfr344 UTSW 2 36568822 missense probably damaging 1.00
R0611:Olfr344 UTSW 2 36569556 splice site probably null
R1503:Olfr344 UTSW 2 36568873 missense probably damaging 1.00
R1844:Olfr344 UTSW 2 36568777 missense probably damaging 1.00
R4088:Olfr344 UTSW 2 36569018 missense probably damaging 1.00
R5243:Olfr344 UTSW 2 36568643 missense probably damaging 1.00
R5747:Olfr344 UTSW 2 36568967 missense probably damaging 0.98
R5948:Olfr344 UTSW 2 36569351 missense probably damaging 1.00
R6115:Olfr344 UTSW 2 36568951 missense probably damaging 1.00
R6158:Olfr344 UTSW 2 36569116 missense probably benign 0.03
R6198:Olfr344 UTSW 2 36568951 missense probably damaging 1.00
R6531:Olfr344 UTSW 2 36569341 missense probably damaging 1.00
R7075:Olfr344 UTSW 2 36569180 missense probably benign 0.01
R7193:Olfr344 UTSW 2 36569236 missense probably benign 0.06
R7329:Olfr344 UTSW 2 36568696 missense probably benign
R7659:Olfr344 UTSW 2 36568625 missense possibly damaging 0.90
R8251:Olfr344 UTSW 2 36569455 missense probably damaging 1.00
R8383:Olfr344 UTSW 2 36569002 missense probably benign 0.08
R8507:Olfr344 UTSW 2 36569431 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTTGGTAAATTATGTCTCTTTCCC -3'
(R):5'- TGTTAAGGCCAAGTGACTGAG -3'

Sequencing Primer
(F):5'- GTAGCTCATTACCATGACAAAAGTC -3'
(R):5'- CCAAGTGACTGAGAAAGAAGTACATG -3'
Posted On2014-10-30