Incidental Mutation 'R2320:Thbd'
ID245604
Institutional Source Beutler Lab
Gene Symbol Thbd
Ensembl Gene ENSMUSG00000074743
Gene Namethrombomodulin
SynonymsCD141, TM
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location148404466-148408188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 148406646 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 434 (E434G)
Ref Sequence ENSEMBL: ENSMUSP00000096877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099270]
Predicted Effect probably damaging
Transcript: ENSMUST00000099270
AA Change: E434G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096877
Gene: ENSMUSG00000074743
AA Change: E434G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
CLECT 24 166 2.78e-18 SMART
EGF 243 280 2.2e1 SMART
EGF 286 323 1.47e-3 SMART
EGF_CA 324 362 7.81e-8 SMART
EGF 367 404 3.57e-2 SMART
EGF 406 439 2.53e1 SMART
EGF 443 480 2.39e1 SMART
low complexity region 490 511 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this intronless gene is an endothelial-specific type I membrane receptor that binds thrombin. This binding results in the activation of protein C, which degrades clotting factors Va and VIIIa and reduces the amount of thrombin generated. Mutations in this gene are a cause of thromboembolic disease, also known as inherited thrombophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted null mutants are growth retarded and die by embryonic day 9.5. Embryos develop further in vitro than in vivo suggesting maternal-fetal incompatibility. Endothelial cell-specific, conditional knockouts suffer fatal juvenile thromboses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Thbd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Thbd APN 2 148407682 nonsense probably null
IGL01510:Thbd APN 2 148406974 missense probably damaging 1.00
IGL01845:Thbd APN 2 148407096 missense probably benign
IGL01892:Thbd APN 2 148407068 missense possibly damaging 0.68
IGL02039:Thbd APN 2 148406542 missense probably benign 0.05
IGL02261:Thbd APN 2 148406481 missense probably benign
IGL02941:Thbd APN 2 148407034 missense probably damaging 1.00
IGL03110:Thbd APN 2 148406796 missense probably benign
IGL03111:Thbd APN 2 148406472 missense probably benign 0.00
F5770:Thbd UTSW 2 148407190 missense probably benign 0.05
PIT4283001:Thbd UTSW 2 148407083 missense probably benign 0.19
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R0102:Thbd UTSW 2 148406983 missense probably damaging 1.00
R1847:Thbd UTSW 2 148407684 nonsense probably null
R1957:Thbd UTSW 2 148406979 missense probably damaging 0.97
R2362:Thbd UTSW 2 148406364 missense probably damaging 1.00
R2900:Thbd UTSW 2 148406214 makesense probably null
R3623:Thbd UTSW 2 148406973 missense probably damaging 1.00
R4839:Thbd UTSW 2 148406671 missense probably damaging 1.00
R4936:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5296:Thbd UTSW 2 148406983 missense probably damaging 1.00
R5521:Thbd UTSW 2 148407735 missense probably damaging 1.00
R5677:Thbd UTSW 2 148407366 missense probably damaging 1.00
R6581:Thbd UTSW 2 148406272 missense probably benign
R7139:Thbd UTSW 2 148406541 missense probably benign 0.37
R7246:Thbd UTSW 2 148406485 missense probably benign
R7655:Thbd UTSW 2 148407420 missense probably damaging 1.00
R7656:Thbd UTSW 2 148407420 missense probably damaging 1.00
R7752:Thbd UTSW 2 148406974 missense probably damaging 0.99
R7867:Thbd UTSW 2 148407744 missense probably damaging 1.00
R8398:Thbd UTSW 2 148406680 missense probably benign 0.00
R8429:Thbd UTSW 2 148407537 missense possibly damaging 0.70
V7582:Thbd UTSW 2 148407190 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGGAGATGCCAATGAGCACG -3'
(R):5'- ACTGCGAGTTTCAGTGCCAG -3'

Sequencing Primer
(F):5'- TGCACTGGCCTTGCAGAAG -3'
(R):5'- AGTTTCAGTGCCAGCCAGTG -3'
Posted On2014-10-30