Incidental Mutation 'R2320:Vmn1r38'
ID245607
Institutional Source Beutler Lab
Gene Symbol Vmn1r38
Ensembl Gene ENSMUSG00000115170
Gene Namevomeronasal 1 receptor 38
SynonymsV1rc13
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location66774003-66782627 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66776550 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 194 (T194I)
Ref Sequence ENSEMBL: ENSMUSP00000154495 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176121] [ENSMUST00000226457] [ENSMUST00000227493] [ENSMUST00000227694]
Predicted Effect possibly damaging
Transcript: ENSMUST00000176121
AA Change: T194I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135117
Gene: ENSMUSG00000093632
AA Change: T194I

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.7e-53 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226457
AA Change: T194I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227493
AA Change: T194I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000227694
AA Change: T194I

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Vmn1r38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01892:Vmn1r38 APN 6 66776376 missense probably benign 0.00
IGL02471:Vmn1r38 APN 6 66776767 missense probably benign 0.06
R0483:Vmn1r38 UTSW 6 66776995 missense probably benign 0.10
R0890:Vmn1r38 UTSW 6 66776530 missense probably benign 0.01
R1242:Vmn1r38 UTSW 6 66776360 nonsense probably null
R1557:Vmn1r38 UTSW 6 66776386 missense probably benign 0.01
R2266:Vmn1r38 UTSW 6 66776449 missense probably benign 0.02
R2568:Vmn1r38 UTSW 6 66776971 missense probably benign 0.00
R3104:Vmn1r38 UTSW 6 66776446 missense probably benign 0.31
R3552:Vmn1r38 UTSW 6 66776493 missense possibly damaging 0.95
R3792:Vmn1r38 UTSW 6 66776907 missense probably benign 0.01
R4061:Vmn1r38 UTSW 6 66776848 missense possibly damaging 0.87
R4532:Vmn1r38 UTSW 6 66777032 missense probably benign 0.38
R5299:Vmn1r38 UTSW 6 66776698 missense probably benign 0.06
R7173:Vmn1r38 UTSW 6 66776294 missense possibly damaging 0.88
R8044:Vmn1r38 UTSW 6 66776532 missense probably benign 0.12
X0022:Vmn1r38 UTSW 6 66777067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACAGTAAGCATGACTGGGTC -3'
(R):5'- GATCAGTCCCAACTCCGCTTTG -3'

Sequencing Primer
(F):5'- GGGTCATACATCCATAAAAAGACTG -3'
(R):5'- CTCCGCTTTGTTGGCAAAATTTAAAC -3'
Posted On2014-10-30