Incidental Mutation 'R2320:Zfp709'
ID245610
Institutional Source Beutler Lab
Gene Symbol Zfp709
Ensembl Gene ENSMUSG00000056019
Gene Namezinc finger protein 709
SynonymsGIOT-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location71882019-71895727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71887292 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 11 (V11E)
Ref Sequence ENSEMBL: ENSMUSP00000140285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034259] [ENSMUST00000188374] [ENSMUST00000188685]
Predicted Effect probably damaging
Transcript: ENSMUST00000034259
AA Change: V10E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034259
Gene: ENSMUSG00000056019
AA Change: V10E

DomainStartEndE-ValueType
KRAB 3 68 3.08e-15 SMART
ZnF_C2H2 224 246 6.78e-3 SMART
ZnF_C2H2 252 274 2.09e-3 SMART
ZnF_C2H2 280 302 2.05e-2 SMART
ZnF_C2H2 308 330 2.4e-3 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 1.36e-2 SMART
ZnF_C2H2 392 414 1.69e-3 SMART
ZnF_C2H2 420 442 5.14e-3 SMART
ZnF_C2H2 448 470 1.67e-2 SMART
ZnF_C2H2 476 498 1.1e-2 SMART
ZnF_C2H2 504 526 2.86e-1 SMART
ZnF_C2H2 532 554 7.26e-3 SMART
ZnF_C2H2 560 582 8.34e-3 SMART
ZnF_C2H2 588 610 1.5e-4 SMART
ZnF_C2H2 616 638 1.18e-2 SMART
ZnF_C2H2 644 666 1.06e-4 SMART
ZnF_C2H2 672 694 1.18e-2 SMART
ZnF_C2H2 700 722 8.94e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188374
AA Change: V11E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141000
Gene: ENSMUSG00000056019
AA Change: V11E

DomainStartEndE-ValueType
KRAB 4 56 9.2e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188685
AA Change: V11E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140285
Gene: ENSMUSG00000056019
AA Change: V11E

DomainStartEndE-ValueType
KRAB 4 69 3.08e-15 SMART
ZnF_C2H2 225 247 6.78e-3 SMART
ZnF_C2H2 253 275 2.09e-3 SMART
ZnF_C2H2 281 303 2.05e-2 SMART
ZnF_C2H2 309 331 2.4e-3 SMART
ZnF_C2H2 337 359 1.36e-2 SMART
ZnF_C2H2 365 387 1.36e-2 SMART
ZnF_C2H2 393 415 1.69e-3 SMART
ZnF_C2H2 421 443 5.14e-3 SMART
ZnF_C2H2 449 471 1.67e-2 SMART
ZnF_C2H2 477 499 1.1e-2 SMART
ZnF_C2H2 505 527 2.86e-1 SMART
ZnF_C2H2 533 555 7.26e-3 SMART
ZnF_C2H2 561 583 8.34e-3 SMART
ZnF_C2H2 589 611 1.5e-4 SMART
ZnF_C2H2 617 639 1.18e-2 SMART
ZnF_C2H2 645 667 1.06e-4 SMART
ZnF_C2H2 673 695 1.18e-2 SMART
ZnF_C2H2 701 723 8.94e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203585
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc finger proteins (ZNFs) bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. For a general description of these proteins, see ZNF91 (MIM 603971).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Other mutations in Zfp709
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03174:Zfp709 APN 8 71889026 missense probably benign 0.03
IGL03187:Zfp709 APN 8 71889282 missense probably benign 0.41
BB007:Zfp709 UTSW 8 71890840 missense probably damaging 0.97
BB017:Zfp709 UTSW 8 71890840 missense probably damaging 0.97
R0336:Zfp709 UTSW 8 71890605 missense probably damaging 1.00
R1386:Zfp709 UTSW 8 71890662 missense probably damaging 0.99
R1878:Zfp709 UTSW 8 71890047 missense probably damaging 1.00
R2279:Zfp709 UTSW 8 71889090 missense probably benign 0.31
R2885:Zfp709 UTSW 8 71889705 missense probably benign 0.08
R3833:Zfp709 UTSW 8 71889062 missense probably benign 0.00
R3926:Zfp709 UTSW 8 71890553 missense probably damaging 1.00
R4165:Zfp709 UTSW 8 71890805 nonsense probably null
R4179:Zfp709 UTSW 8 71889906 missense probably damaging 1.00
R4963:Zfp709 UTSW 8 71889788 missense probably benign 0.27
R5340:Zfp709 UTSW 8 71889752 missense probably damaging 1.00
R5427:Zfp709 UTSW 8 71889132 missense probably benign 0.27
R5513:Zfp709 UTSW 8 71890056 missense probably damaging 1.00
R5639:Zfp709 UTSW 8 71889991 splice site probably null
R5692:Zfp709 UTSW 8 71890155 missense probably damaging 1.00
R5872:Zfp709 UTSW 8 71889519 missense probably benign 0.03
R5940:Zfp709 UTSW 8 71890220 missense possibly damaging 0.85
R6192:Zfp709 UTSW 8 71890708 small deletion probably benign
R6210:Zfp709 UTSW 8 71890708 small deletion probably benign
R6225:Zfp709 UTSW 8 71890708 small deletion probably benign
R6227:Zfp709 UTSW 8 71890708 small deletion probably benign
R6228:Zfp709 UTSW 8 71890708 small deletion probably benign
R6246:Zfp709 UTSW 8 71890708 small deletion probably benign
R6247:Zfp709 UTSW 8 71890708 small deletion probably benign
R6248:Zfp709 UTSW 8 71890708 small deletion probably benign
R6249:Zfp709 UTSW 8 71890708 small deletion probably benign
R6250:Zfp709 UTSW 8 71890708 small deletion probably benign
R6258:Zfp709 UTSW 8 71890708 small deletion probably benign
R6259:Zfp709 UTSW 8 71890708 small deletion probably benign
R6371:Zfp709 UTSW 8 71889485 missense probably damaging 1.00
R6875:Zfp709 UTSW 8 71889007 missense possibly damaging 0.93
R7871:Zfp709 UTSW 8 71889464 missense probably benign 0.02
R7930:Zfp709 UTSW 8 71890840 missense probably damaging 0.97
R7943:Zfp709 UTSW 8 71890089 missense probably damaging 1.00
R8202:Zfp709 UTSW 8 71888916 splice site probably null
Predicted Primers PCR Primer
(F):5'- CCAGCAGGATAGTTGGTATGTG -3'
(R):5'- TGACCATGCCTGATAAAGCC -3'

Sequencing Primer
(F):5'- GTTGCTTCAAAGATAATGTGGGG -3'
(R):5'- TGATAAAGCCACCAACTTTACCTTC -3'
Posted On2014-10-30