Incidental Mutation 'R2320:Anapc10'
ID245611
Institutional Source Beutler Lab
Gene Symbol Anapc10
Ensembl Gene ENSMUSG00000036977
Gene Nameanaphase promoting complex subunit 10
SynonymsA830003M23Rik, Apc10, 1500026N15Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location79711820-79779059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79775079 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 159 (Y159H)
Ref Sequence ENSEMBL: ENSMUSP00000148220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048147] [ENSMUST00000210812]
Predicted Effect probably benign
Transcript: ENSMUST00000048147
AA Change: Y159H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048244
Gene: ENSMUSG00000036977
AA Change: Y159H

DomainStartEndE-ValueType
APC10 22 184 7.76e-96 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210550
Predicted Effect probably benign
Transcript: ENSMUST00000210812
AA Change: Y159H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ANAPC10 is a core subunit of the anaphase-promoting complex (APC), or cyclosome, a ubiquitin protein ligase that is essential for progression through the cell cycle. APC initiates sister chromatid separation by ubiquitinating the anaphase inhibitor securin (PTTG1; MIM 604147) and triggers exit from mitosis by ubiquitinating cyclin B (CCNB1; MIM 123836), the activating subunit of cyclin-dependent kinase-1 (CDK1; MIM 116940) (summary by Wendt et al., 2001 [PubMed 11524682]).[supplied by OMIM, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Anapc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Anapc10 APN 8 79713166 start codon destroyed probably null 0.98
R0498:Anapc10 UTSW 8 79774981 missense probably benign 0.00
R1586:Anapc10 UTSW 8 79775143 missense probably benign 0.00
R4885:Anapc10 UTSW 8 79729150 missense probably benign 0.03
R6776:Anapc10 UTSW 8 79719745 missense probably damaging 1.00
R7566:Anapc10 UTSW 8 79719679 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCCAAGTAAGGTGGTTAGTATTGTTAC -3'
(R):5'- GCAAAGTAACATGACTTTTCACCAAAG -3'

Sequencing Primer
(F):5'- ATTGGTGGAACCAAGTGG -3'
(R):5'- ACATGACTTTTCACCAAAGATACTTG -3'
Posted On2014-10-30