Incidental Mutation 'R2320:Rpl4'
ID245612
Institutional Source Beutler Lab
Gene Symbol Rpl4
Ensembl Gene ENSMUSG00000032399
Gene Nameribosomal protein L4
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64173375-64178666 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64175599 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 100 (R100C)
Ref Sequence ENSEMBL: ENSMUSP00000034966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034965] [ENSMUST00000034966] [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably benign
Transcript: ENSMUST00000034965
SMART Domains Protein: ENSMUSP00000034965
Gene: ENSMUSG00000032398

DomainStartEndE-ValueType
Pfam:SNAPc19 7 101 5.4e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034966
AA Change: R100C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034966
Gene: ENSMUSG00000032399
AA Change: R100C

DomainStartEndE-ValueType
Pfam:Ribosomal_L4 22 263 9.7e-47 PFAM
Pfam:Ribos_L4_asso_C 275 349 4e-34 PFAM
low complexity region 352 367 N/A INTRINSIC
low complexity region 375 419 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083895
Predicted Effect probably benign
Transcript: ENSMUST00000122091
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124301
SMART Domains Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 3e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000130127
SMART Domains Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 72 154 8e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151428
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176378
SMART Domains Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 1e-31 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000176794
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177045
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217055
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L4E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Rpl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Rpl4 APN 9 64174939 missense probably damaging 1.00
IGL02142:Rpl4 APN 9 64176206 missense possibly damaging 0.86
IGL02746:Rpl4 APN 9 64175650 missense probably benign 0.00
IGL03084:Rpl4 APN 9 64178317 unclassified probably benign
IGL03332:Rpl4 APN 9 64176088 unclassified probably benign
R4990:Rpl4 UTSW 9 64174885 missense probably benign 0.15
R6880:Rpl4 UTSW 9 64177053 missense probably damaging 1.00
R7734:Rpl4 UTSW 9 64177379 missense probably benign 0.29
R7985:Rpl4 UTSW 9 64177930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAACTTGCAGTGATGTC -3'
(R):5'- AGTGACTTTAGCAGGCAGAG -3'

Sequencing Primer
(F):5'- AACTTGCAGTGATGTCGTAATTTGC -3'
(R):5'- TGACTTTAGCAGGCAGAGAGAAAC -3'
Posted On2014-10-30