Mutagenetix > Incidental Mutation

Incidental Mutation 'R2320:Rpl4'

245612

Institutional Source

Beutler Lab

Gene Symbol

Rpl4

Ensembl Gene

ENSMUSG00000032399

Gene Name

ribosomal protein L4

Synonyms

2010004J23Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R2320 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64080657-64085948 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 64082881 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 100 (R100C)

Ref Sequence

ENSEMBL: ENSMUSP00000034966 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034965] [ENSMUST00000034966] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000177045]

AlphaFold

Q9D8E6

Predicted Effect

probably benign
Transcript: ENSMUST00000034965

SMART Domains

Protein: ENSMUSP00000034965
Gene: ENSMUSG00000032398

Domain	Start	End	E-Value	Type
Pfam:SNAPc19	7	101	5.4e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000034966
AA Change: R100C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000034966
Gene: ENSMUSG00000032399
AA Change: R100C

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L4	22	263	9.7e-47	PFAM
Pfam:Ribos_L4_asso_C	275	349	4e-34	PFAM
low complexity region	352	367	N/A	INTRINSIC
low complexity region	375	419	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082580

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082984

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083425

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083818

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151428

Predicted Effect

probably benign
Transcript: ENSMUST00000176299

SMART Domains

Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
Pfam:DUF2352	1	471	2.9e-192	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176378

SMART Domains

Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
PDB:3IF8\|A	3	74	1e-31	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213760

Predicted Effect

probably benign
Transcript: ENSMUST00000176794

SMART Domains

Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
Pfam:DUF2352	38	257	8e-67	PFAM
Pfam:DUF2352	254	568	4.4e-131	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000122091

SMART Domains

Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
Pfam:DUF2352	38	589	6e-206	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124301

SMART Domains

Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
PDB:3IF8\|A	3	74	3e-31	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000130127

SMART Domains

Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
Pfam:DUF2352	72	154	8e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000217055

Predicted Effect

probably benign
Transcript: ENSMUST00000177045

SMART Domains

Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400

Domain	Start	End	E-Value	Type
Pfam:DUF2352	19	303	2.2e-93	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L4E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 17 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc10	T	C	8: 80,501,708 (GRCm39)	Y159H	probably benign	Het
Arid1a	A	T	4: 133,407,840 (GRCm39)	N2222K	unknown	Het
Cpxm1	A	G	2: 130,236,131 (GRCm39)	Y344H	probably damaging	Het
Itpr3	T	C	17: 27,314,889 (GRCm39)	S679P	probably benign	Het
Macf1	T	C	4: 123,333,288 (GRCm39)	T2376A	probably benign	Het
Med4	T	A	14: 73,755,373 (GRCm39)	M227K	possibly damaging	Het
Ncan	T	C	8: 70,560,868 (GRCm39)	I700V	probably benign	Het
Or1j15	T	A	2: 36,458,637 (GRCm39)	V9E	possibly damaging	Het
Pik3c2b	A	T	1: 133,031,151 (GRCm39)	S1486C	probably damaging	Het
Ralbp1	A	G	17: 66,159,742 (GRCm39)	I507T	possibly damaging	Het
Scn5a	C	A	9: 119,359,022 (GRCm39)		probably null	Het
Serhl	A	G	15: 82,986,073 (GRCm39)	D2G	probably damaging	Het
Thbd	T	C	2: 148,248,566 (GRCm39)	E434G	probably damaging	Het
Trim17	T	C	11: 58,857,624 (GRCm39)	Y152H	probably benign	Het
Vmn1r38	G	A	6: 66,753,534 (GRCm39)	T194I	possibly damaging	Het
Wdhd1	C	T	14: 47,511,485 (GRCm39)	V76I	probably benign	Het
Zfp709	T	A	8: 72,641,136 (GRCm39)	V11E	probably damaging	Het

Other mutations in Rpl4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01761:Rpl4	APN	9	64,082,221 (GRCm39)	missense	probably damaging	1.00
IGL02142:Rpl4	APN	9	64,083,488 (GRCm39)	missense	possibly damaging	0.86
IGL02746:Rpl4	APN	9	64,082,932 (GRCm39)	missense	probably benign	0.00
IGL03084:Rpl4	APN	9	64,085,599 (GRCm39)	unclassified	probably benign
IGL03332:Rpl4	APN	9	64,083,370 (GRCm39)	unclassified	probably benign
R4990:Rpl4	UTSW	9	64,082,167 (GRCm39)	missense	probably benign	0.15
R6880:Rpl4	UTSW	9	64,084,335 (GRCm39)	missense	probably damaging	1.00
R7734:Rpl4	UTSW	9	64,084,661 (GRCm39)	missense	probably benign	0.29
R7985:Rpl4	UTSW	9	64,085,212 (GRCm39)	missense	probably damaging	1.00
R8754:Rpl4	UTSW	9	64,082,242 (GRCm39)	missense	probably damaging	1.00
R8941:Rpl4	UTSW	9	64,082,245 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGGAACTTGCAGTGATGTC -3'
(R):5'- AGTGACTTTAGCAGGCAGAG -3'

Sequencing Primer
(F):5'- AACTTGCAGTGATGTCGTAATTTGC -3'
(R):5'- TGACTTTAGCAGGCAGAGAGAAAC -3'

Posted On

2014-10-30