Incidental Mutation 'R2320:Med4'
ID245617
Institutional Source Beutler Lab
Gene Symbol Med4
Ensembl Gene ENSMUSG00000022109
Gene Namemediator complex subunit 4
Synonymsp36 TRAP/SMCC/PC2 subunit, DRIP36, 2410046H15Rik, Vdrip, TRAP36, HSPC126, MED4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location73510025-73518849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73517933 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 227 (M227K)
Ref Sequence ENSEMBL: ENSMUSP00000022705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022705] [ENSMUST00000043813]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022705
AA Change: M227K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022705
Gene: ENSMUSG00000022109
AA Change: M227K

DomainStartEndE-ValueType
Pfam:Med4 63 206 7.8e-34 PFAM
low complexity region 259 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043813
SMART Domains Protein: ENSMUSP00000039537
Gene: ENSMUSG00000033405

DomainStartEndE-ValueType
Pfam:NUDIX 11 142 1.5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228141
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Mediator complex. The Mediator complex interacts with DNA-binding gene-specific transcription factors to modulate transcription by RNA polymerase II. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Med4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Med4 APN 14 73517267 missense probably damaging 1.00
IGL02728:Med4 APN 14 73517975 missense possibly damaging 0.87
IGL02964:Med4 APN 14 73517921 missense probably damaging 0.98
R0718:Med4 UTSW 14 73516657 missense probably damaging 1.00
R2131:Med4 UTSW 14 73517996 missense possibly damaging 0.82
R2156:Med4 UTSW 14 73518032 unclassified probably benign
R4454:Med4 UTSW 14 73518062 unclassified probably benign
R5361:Med4 UTSW 14 73510113 nonsense probably null
R6419:Med4 UTSW 14 73513923 missense probably damaging 1.00
R8461:Med4 UTSW 14 73518028 missense unknown
Predicted Primers PCR Primer
(F):5'- ATCCCTAACCTTGTTAGATCCTTGG -3'
(R):5'- CCGCTGATTTTCATGGGCTC -3'

Sequencing Primer
(F):5'- CCTTGTTAGATCCTTGGTACTACAAG -3'
(R):5'- CGCTGATTTTCATGGGCTCCTTAG -3'
Posted On2014-10-30