Incidental Mutation 'R2320:Serhl'
ID245618
Institutional Source Beutler Lab
Gene Symbol Serhl
Ensembl Gene ENSMUSG00000058586
Gene Nameserine hydrolase-like
Synonyms1110019M09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location83089506-83116674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83101872 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000128251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078218] [ENSMUST00000166427] [ENSMUST00000167389] [ENSMUST00000167862] [ENSMUST00000168029]
Predicted Effect probably benign
Transcript: ENSMUST00000078218
AA Change: D52G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077345
Gene: ENSMUSG00000058586
AA Change: D52G

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 28 282 1.4e-10 PFAM
Pfam:Abhydrolase_6 29 295 2.9e-28 PFAM
Pfam:Abhydrolase_1 53 260 1.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165371
Predicted Effect possibly damaging
Transcript: ENSMUST00000166427
AA Change: D62G

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132686
Gene: ENSMUSG00000058586
AA Change: D62G

DomainStartEndE-ValueType
Pfam:Hydrolase_4 33 194 7.4e-11 PFAM
Pfam:Abhydrolase_1 37 299 4e-20 PFAM
Pfam:Abhydrolase_5 38 292 4.4e-10 PFAM
Pfam:Abhydrolase_6 39 305 6.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167389
AA Change: D2G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128251
Gene: ENSMUSG00000058586
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 2 54 4.3e-8 PFAM
Pfam:Abhydrolase_1 3 54 1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167750
Predicted Effect probably benign
Transcript: ENSMUST00000167862
Predicted Effect probably benign
Transcript: ENSMUST00000168029
SMART Domains Protein: ENSMUSP00000128802
Gene: ENSMUSG00000058586

DomainStartEndE-ValueType
Pfam:Abhydrolase_1 1 96 3.3e-15 PFAM
Pfam:Abhydrolase_6 1 97 2.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169702
Predicted Effect probably benign
Transcript: ENSMUST00000169814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172101
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171488
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Ralbp1 A G 17: 65,852,747 I507T possibly damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Serhl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Serhl APN 15 83104373 missense probably benign 0.15
IGL00425:Serhl APN 15 83105637 missense possibly damaging 0.79
R1544:Serhl UTSW 15 83105676 missense probably damaging 1.00
R2119:Serhl UTSW 15 83115575 missense probably benign 0.19
R3236:Serhl UTSW 15 83104403 missense probably damaging 0.96
R5156:Serhl UTSW 15 83102694 unclassified probably benign
R5256:Serhl UTSW 15 83102634 missense probably damaging 1.00
R5822:Serhl UTSW 15 83116327 missense probably benign 0.02
R5951:Serhl UTSW 15 83103036 unclassified probably benign
R6385:Serhl UTSW 15 83101622 missense probably benign
R6521:Serhl UTSW 15 83101642 critical splice acceptor site probably null
R7959:Serhl UTSW 15 83101872 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCACTCAGAGTTGAAGTTGG -3'
(R):5'- TGCCTCCCAGATACTGCATC -3'

Sequencing Primer
(F):5'- CACATTGCTCTCAAAGTCTGGGG -3'
(R):5'- TCCTACTCCTAGGATGAGAGATAC -3'
Posted On2014-10-30