Incidental Mutation 'R2320:Ralbp1'
ID245621
Institutional Source Beutler Lab
Gene Symbol Ralbp1
Ensembl Gene ENSMUSG00000024096
Gene NameralA binding protein 1
SynonymsRLIP76, Rip1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R2320 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location65848433-65885755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65852747 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 507 (I507T)
Ref Sequence ENSEMBL: ENSMUSP00000129448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024905] [ENSMUST00000166543]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024905
AA Change: I507T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024905
Gene: ENSMUSG00000024096
AA Change: I507T

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
low complexity region 112 152 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
RhoGAP 207 373 1.04e-60 SMART
Blast:RhoGAP 391 493 1e-48 BLAST
low complexity region 533 551 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 602 621 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166543
AA Change: I507T

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129448
Gene: ENSMUSG00000024096
AA Change: I507T

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
low complexity region 112 152 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
RhoGAP 207 373 1.04e-60 SMART
Blast:RhoGAP 391 493 1e-48 BLAST
low complexity region 533 551 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 602 621 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RALBP1 plays a role in receptor-mediated endocytosis and is a downstream effector of the small GTP-binding protein RAL (see RALA; MIM 179550). Small G proteins, such as RAL, have GDP-bound inactive and GTP-bound active forms, which shift from the inactive to the active state through the action of RALGDS (MIM 601619), which in turn is activated by RAS (see HRAS; MIM 190020) (summary by Feig, 2003 [PubMed 12888294]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous and heterozygous null mice display increased sensitivity to X-ray irradiation, increased oxidative stress, and impaired glutathione homeostasis. Mice homozygous for a gene trap insertion exhibit decreases in exploratory and locomotor activity and a decreased sensitivity to pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 17 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc10 T C 8: 79,775,079 Y159H probably benign Het
Arid1a A T 4: 133,680,529 N2222K unknown Het
Cpxm1 A G 2: 130,394,211 Y344H probably damaging Het
Itpr3 T C 17: 27,095,915 S679P probably benign Het
Macf1 T C 4: 123,439,495 T2376A probably benign Het
Med4 T A 14: 73,517,933 M227K possibly damaging Het
Ncan T C 8: 70,108,218 I700V probably benign Het
Olfr344 T A 2: 36,568,625 V9E possibly damaging Het
Pik3c2b A T 1: 133,103,413 S1486C probably damaging Het
Rpl4 C T 9: 64,175,599 R100C probably damaging Het
Scn5a C A 9: 119,529,956 probably null Het
Serhl A G 15: 83,101,872 D2G probably damaging Het
Thbd T C 2: 148,406,646 E434G probably damaging Het
Trim17 T C 11: 58,966,798 Y152H probably benign Het
Vmn1r38 G A 6: 66,776,550 T194I possibly damaging Het
Wdhd1 C T 14: 47,274,028 V76I probably benign Het
Zfp709 T A 8: 71,887,292 V11E probably damaging Het
Other mutations in Ralbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ralbp1 APN 17 65864612 missense possibly damaging 0.87
IGL00736:Ralbp1 APN 17 65864723 missense probably damaging 1.00
IGL01318:Ralbp1 APN 17 65864282 missense probably damaging 1.00
IGL01661:Ralbp1 APN 17 65861389 missense probably damaging 0.99
IGL02523:Ralbp1 APN 17 65859091 missense probably damaging 0.99
R0507:Ralbp1 UTSW 17 65849960 missense probably benign 0.08
R0666:Ralbp1 UTSW 17 65854129 missense probably benign 0.28
R0674:Ralbp1 UTSW 17 65852753 missense probably benign 0.28
R1418:Ralbp1 UTSW 17 65859148 splice site probably benign
R2136:Ralbp1 UTSW 17 65864666 missense probably damaging 1.00
R4657:Ralbp1 UTSW 17 65852691 missense probably null 0.99
R5482:Ralbp1 UTSW 17 65861568 nonsense probably null
R5545:Ralbp1 UTSW 17 65850104 missense possibly damaging 0.77
R5967:Ralbp1 UTSW 17 65864279 missense probably benign 0.19
R6512:Ralbp1 UTSW 17 65861275 missense probably damaging 1.00
R6853:Ralbp1 UTSW 17 65852756 missense possibly damaging 0.86
R7399:Ralbp1 UTSW 17 65854148 missense probably benign 0.01
R7423:Ralbp1 UTSW 17 65858981 missense probably damaging 0.99
R7545:Ralbp1 UTSW 17 65867598 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCCAGTTCTTTCCAGGAATG -3'
(R):5'- GTTGTAGTAACTTGTGTTCAGCAC -3'

Sequencing Primer
(F):5'- AACCTGTGGGTCACAAGCTCTATG -3'
(R):5'- CCGAGCAGGGTGACAGG -3'
Posted On2014-10-30