Incidental Mutation 'R2321:Wdr64'
ID245624
Institutional Source Beutler Lab
Gene Symbol Wdr64
Ensembl Gene ENSMUSG00000026523
Gene NameWD repeat domain 64
Synonyms4930511H01Rik, 4930415O10Rik
MMRRC Submission 040313-MU
Accession Numbers

Ncbi RefSeq: NM_029453.2; MGI:1923070

Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2321 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175698593-175815734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 175795087 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 810 (K810T)
Ref Sequence ENSEMBL: ENSMUSP00000091846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094288] [ENSMUST00000171939] [ENSMUST00000194087] [ENSMUST00000194783]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094288
AA Change: K810T

PolyPhen 2 Score 0.571 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091846
Gene: ENSMUSG00000026523
AA Change: K810T

DomainStartEndE-ValueType
WD40 118 159 2.65e1 SMART
WD40 162 200 2.13e1 SMART
low complexity region 259 271 N/A INTRINSIC
Blast:WD40 277 316 5e-19 BLAST
WD40 323 361 2.4e-1 SMART
WD40 365 404 8.29e-1 SMART
WD40 407 449 1.7e2 SMART
WD40 457 493 1.19e1 SMART
WD40 497 538 4.55e-3 SMART
WD40 643 684 3.31e0 SMART
WD40 742 806 7.4e0 SMART
Blast:WD40 811 851 7e-17 BLAST
WD40 864 903 4.62e-4 SMART
Blast:XPGN 921 964 9e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171939
AA Change: K800T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000128678
Gene: ENSMUSG00000026523
AA Change: K800T

DomainStartEndE-ValueType
WD40 151 190 5.73e0 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 306 4e-19 BLAST
WD40 313 351 2.4e-1 SMART
WD40 355 394 8.29e-1 SMART
WD40 397 439 1.7e2 SMART
WD40 447 483 1.19e1 SMART
WD40 487 528 4.55e-3 SMART
WD40 633 674 3.31e0 SMART
WD40 732 796 7.4e0 SMART
Blast:WD40 801 841 5e-17 BLAST
WD40 854 893 4.62e-4 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194087
AA Change: K800T

PolyPhen 2 Score 0.452 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141740
Gene: ENSMUSG00000026523
AA Change: K800T

DomainStartEndE-ValueType
WD40 151 190 3.6e-2 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 305 5e-19 BLAST
WD40 313 351 1.5e-3 SMART
WD40 355 394 5.2e-3 SMART
WD40 397 439 1.1e0 SMART
WD40 447 483 7.6e-2 SMART
WD40 487 528 2.9e-5 SMART
WD40 633 674 2.1e-2 SMART
WD40 732 796 4.7e-2 SMART
Blast:WD40 801 841 6e-17 BLAST
WD40 854 893 2.9e-6 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000194783
AA Change: K359T

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141384
Gene: ENSMUSG00000026523
AA Change: K359T

DomainStartEndE-ValueType
WD40 6 42 7.6e-2 SMART
WD40 46 87 2.9e-5 SMART
WD40 192 233 2.1e-2 SMART
WD40 291 355 4.7e-2 SMART
Blast:WD40 360 400 4e-17 BLAST
WD40 413 452 2.9e-6 SMART
Blast:XPGN 470 519 3e-19 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 100% (39/39)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Abcf2 A T 5: 24,567,253 Y492* probably null Het
Adcy9 A G 16: 4,288,268 V994A probably damaging Het
Arhgef40 T C 14: 51,994,276 probably benign Het
Bhlha15 T C 5: 144,191,196 L42P probably damaging Het
Clca4b C A 3: 144,932,373 A43S probably benign Het
Cpq A G 15: 33,594,145 H434R probably benign Het
Crybg2 A G 4: 134,074,511 E994G probably benign Het
Dcaf1 T C 9: 106,838,473 L263S probably benign Het
Dnajc12 G T 10: 63,407,211 probably benign Het
Fbxo32 T C 15: 58,191,293 I215V possibly damaging Het
Krtap17-1 T C 11: 99,993,920 D7G unknown Het
Men1 A G 19: 6,339,838 D466G possibly damaging Het
Myh15 T A 16: 49,113,073 F624I possibly damaging Het
Ncam1 A C 9: 49,544,832 probably benign Het
Olfr1389 A G 11: 49,431,280 N268S probably benign Het
Otol1 T A 3: 70,018,525 L11* probably null Het
Plekhg4 T C 8: 105,377,540 S447P probably benign Het
Pnmal2 G T 7: 16,945,565 R158L unknown Het
Ppp1r2 A T 16: 31,265,303 probably null Het
Rad51ap2 G A 12: 11,457,057 G327R probably damaging Het
Rbm26 T C 14: 105,153,427 T208A unknown Het
Reln T C 5: 21,915,020 Y2878C probably damaging Het
Rnps1 T A 17: 24,422,168 F181I probably damaging Het
Senp6 A C 9: 80,123,740 I575L possibly damaging Het
Serpinh1 T C 7: 99,346,385 D330G probably damaging Het
Slamf9 G T 1: 172,477,413 C198F probably damaging Het
Slc22a13 A T 9: 119,195,628 V261D possibly damaging Het
Slc26a4 A G 12: 31,540,544 V370A probably damaging Het
Tasp1 A G 2: 140,057,412 M7T probably benign Het
Tet2 T C 3: 133,486,339 N778S possibly damaging Het
Tm9sf4 T A 2: 153,204,586 Y582N probably damaging Het
Tmem131l T A 3: 83,936,023 H508L probably damaging Het
Tmem71 T G 15: 66,552,000 D139A possibly damaging Het
Uroc1 A G 6: 90,347,247 R418G possibly damaging Het
Zgrf1 C A 3: 127,562,407 Y427* probably null Het
Other mutations in Wdr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Wdr64 APN 1 175698800 missense probably benign 0.00
IGL00902:Wdr64 APN 1 175728825 missense probably damaging 1.00
IGL01347:Wdr64 APN 1 175720333 missense probably benign 0.12
IGL01353:Wdr64 APN 1 175731585 missense probably damaging 0.96
IGL01583:Wdr64 APN 1 175767156 critical splice donor site probably null
IGL01643:Wdr64 APN 1 175772311 missense probably damaging 1.00
IGL01673:Wdr64 APN 1 175800356 missense possibly damaging 0.68
IGL01992:Wdr64 APN 1 175706071 missense probably damaging 1.00
IGL02613:Wdr64 APN 1 175767047 nonsense probably null
IGL02834:Wdr64 APN 1 175805849 splice site probably benign
IGL03214:Wdr64 APN 1 175743635 splice site probably benign
IGL03305:Wdr64 APN 1 175755586 missense possibly damaging 0.94
IGL03308:Wdr64 APN 1 175766996 unclassified probably benign
PIT4418001:Wdr64 UTSW 1 175743594 nonsense probably null
R0036:Wdr64 UTSW 1 175728930 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0079:Wdr64 UTSW 1 175795102 missense probably benign 0.02
R0380:Wdr64 UTSW 1 175769642 splice site probably benign
R0486:Wdr64 UTSW 1 175795203 splice site probably benign
R0520:Wdr64 UTSW 1 175726392 missense probably damaging 1.00
R0598:Wdr64 UTSW 1 175805899 missense probably damaging 1.00
R0711:Wdr64 UTSW 1 175772185 missense probably benign 0.39
R0746:Wdr64 UTSW 1 175792973 missense possibly damaging 0.92
R0927:Wdr64 UTSW 1 175793081 missense probably damaging 0.97
R0947:Wdr64 UTSW 1 175775749 missense probably benign
R1014:Wdr64 UTSW 1 175755626 missense probably damaging 1.00
R1332:Wdr64 UTSW 1 175795140 missense possibly damaging 0.82
R1416:Wdr64 UTSW 1 175806002 missense probably benign 0.01
R1421:Wdr64 UTSW 1 175767150 missense possibly damaging 0.85
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1796:Wdr64 UTSW 1 175717331 missense probably damaging 1.00
R1797:Wdr64 UTSW 1 175812019 missense probably damaging 1.00
R2145:Wdr64 UTSW 1 175767095 missense probably benign 0.01
R2449:Wdr64 UTSW 1 175698913 missense probably benign
R4049:Wdr64 UTSW 1 175805856 missense probably benign 0.21
R4155:Wdr64 UTSW 1 175769606 missense probably benign 0.03
R4624:Wdr64 UTSW 1 175772263 missense probably benign
R4661:Wdr64 UTSW 1 175726494 missense probably damaging 1.00
R4711:Wdr64 UTSW 1 175799229 missense probably damaging 1.00
R4891:Wdr64 UTSW 1 175698779 unclassified probably benign
R4925:Wdr64 UTSW 1 175724702 splice site probably null
R4943:Wdr64 UTSW 1 175720316 missense probably benign 0.01
R5000:Wdr64 UTSW 1 175726375 splice site probably null
R5001:Wdr64 UTSW 1 175792959 critical splice acceptor site probably null
R5143:Wdr64 UTSW 1 175726413 missense probably damaging 1.00
R5395:Wdr64 UTSW 1 175755598 missense probably damaging 1.00
R5813:Wdr64 UTSW 1 175812057 missense possibly damaging 0.89
R6014:Wdr64 UTSW 1 175805990 missense possibly damaging 0.56
R6417:Wdr64 UTSW 1 175726390 missense probably damaging 1.00
R6456:Wdr64 UTSW 1 175785609 critical splice donor site probably null
R6555:Wdr64 UTSW 1 175720290 missense probably damaging 1.00
R6576:Wdr64 UTSW 1 175805928 missense possibly damaging 0.82
R6797:Wdr64 UTSW 1 175810610 critical splice donor site probably null
R6891:Wdr64 UTSW 1 175706068 missense probably damaging 1.00
R6959:Wdr64 UTSW 1 175705989 missense probably damaging 1.00
R7205:Wdr64 UTSW 1 175789933 missense probably benign 0.34
R7252:Wdr64 UTSW 1 175775674 missense probably benign 0.00
R7552:Wdr64 UTSW 1 175785581 missense possibly damaging 0.71
R7732:Wdr64 UTSW 1 175789929 missense probably benign
R7777:Wdr64 UTSW 1 175789998 missense possibly damaging 0.71
R7780:Wdr64 UTSW 1 175728976 missense probably damaging 1.00
R7810:Wdr64 UTSW 1 175731526 missense probably benign 0.01
R7833:Wdr64 UTSW 1 175763945 missense probably damaging 1.00
R7843:Wdr64 UTSW 1 175812102 missense probably benign 0.00
R7887:Wdr64 UTSW 1 175785545 missense not run
R7916:Wdr64 UTSW 1 175763945 missense probably damaging 1.00
R7926:Wdr64 UTSW 1 175812102 missense probably benign 0.00
R7970:Wdr64 UTSW 1 175785545 missense not run
R8129:Wdr64 UTSW 1 175775588 missense probably damaging 0.96
Z1088:Wdr64 UTSW 1 175705985 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TAAGTCCTCATGGATAAGGTCAAG -3'
(R):5'- ACGTGTGTTTCTCAAAAGCTG -3'

Sequencing Primer
(F):5'- AGGTCAAGTTATTTTTAGTGCAGATG -3'
(R):5'- CTGGAACTCATTCTGTAGACCAGG -3'
Posted On2014-10-30